GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-04-02 14:50:25, GGRNA.v2 : RefSeq release 228 (Jan, 2025)

LOCUS       XM_067361583            3202 bp    mRNA    linear   VRT 19-AUG-2024
DEFINITION  PREDICTED: Chanodichthys erythropterus argonaute RISC component 4
            (ago4), transcript variant X10, mRNA.
ACCESSION   XM_067361583
VERSION     XM_067361583.1
DBLINK      BioProject: PRJNA1148501
KEYWORDS    RefSeq.
SOURCE      Chanodichthys erythropterus (predatory carp)
  ORGANISM  Chanodichthys erythropterus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Xenocyprididae; Xenocypridinae; Chanodichthys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_090235) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_024489055.1-RS_2024_08
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 08/16/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3202
                     /organism="Chanodichthys erythropterus"
                     /mol_type="mRNA"
                     /isolate="Z2021"
                     /isolation_source="lake"
                     /db_xref="taxon:933992"
                     /chromosome="15"
                     /tissue_type="muscle"
                     /geo_loc_name="China: Hulun lake"
     gene            1..3202
                     /gene="ago4"
                     /note="argonaute RISC component 4; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 5
                     Proteins"
                     /db_xref="GeneID:137002086"
     CDS             146..2776
                     /gene="ago4"
                     /codon_start=1
                     /product="protein argonaute-4 isoform X10"
                     /protein_id="XP_067217684.1"
                     /db_xref="GeneID:137002086"
                     /translation="
MEALGPGPPAPPSLFQPPRRPGLGTVGKPIRLLANHFQVQIPKIDVYHYDIDIKPEKRPRRVNREVVDTMVRHFKMQIFGDRQPGYDGKRNMYTAHPLPIGRDRVDLEVTLPGEGKDQTFKVSLQWVSVVSLQMLLEALSGHLNEVPEDSVQALDVITRHLPSMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWNMMLNIDVSATAFYRAQPVIEFMCEVLDIQNINEQTKPLTDSQRVKFTKEIRGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLENGQAMECTVAQYFKQKYSLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVKSNSMVGGPDPYLKEFGIVVHNDMTEVTGRVLPAPMLQYGGRNKTVATPNQGVWDMRGKQFYAGIEIKVWAVACFAPQKQCREDLLKSFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFKHLKMSYVGLQLIVVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINAKLGGINNVLVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDGHPSRYCATVRVQTSRQDLSQEQLFSQEVIQDLTNMVRELLIQFYKSTRFKPTRIIYYRGGVSEGQMKQVAWPELIAIRKACISLEEDYRPGITYIVVQKRHHTRLFCSDKAERVGKSGNVPAGTTVDSTITHPSEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKDHDSCSSSLPSLSETLCAEGSHVSGQSNGRDPQALAKAVQIHYDTQHTMYFA"
     misc_feature    227..616
                     /gene="ago4"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:465134"
     misc_feature    647..799
                     /gene="ago4"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:462567"
     misc_feature    800..1162
                     /gene="ago4"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(956..958,1001..1003,1043..1045,1055..1057,
                     1109..1111,1130..1132,1136..1138)
                     /gene="ago4"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1301..2608
                     /gene="ago4"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1712..1714,1724..1726,1760..1771,1778..1780,
                     1802..1804,1811..1813,1823..1825,1835..1837)
                     /gene="ago4"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1916..1918,1922..1924,2162..2164,2576..2578)
                     /gene="ago4"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
aagacaacgcaagcacagcgctacacatctacgcatccttccatttcttaaattagccaccttaagcttcgagataccgcccccaatttcagtgtcggtacggagccgccaggccgggacagagacggagagagatccctcggccatggaagcgctcggacccggcccgcctgcccctccctccctcttccagccaccgcgccggcccggattgggtacggtggggaagccgattcgcctgctggccaatcacttccaggtgcagatccccaagatcgacgtctaccattacgacatcgacatcaagcctgaaaagcgaccccgcagggtcaacagagaggtggtggacacgatggtgagacactttaagatgcagatcttcggggacagacagcctgggtatgatggcaagaggaacatgtatacggcgcatccgctacccatcggccgggaccgggtggatctggaggtgacgttgccaggcgagggcaaggatcagaccttcaaggtgtctctgcagtgggtgtcggtggtgagtctgcagatgctcctggaagctctgtccggtcacctgaacgaggtcccggaggactctgttcaggctctggatgtcatcactcgtcacctgccctccatgcggtacactccagtcggtcgttctttcttctcaccaccagagggatactatcacccgctgggaggagggagggaggtttggttcggtttccatcagtcggtccgtccagcgatgtggaacatgatgctcaacatagatgtgtcagccacagccttctaccgagcccagcctgtcatcgagttcatgtgtgaggttctggacatccagaacatcaatgagcagaccaaacccctcacagattcacaacgtgtcaagttcaccaaggagatccgaggactgaaagtggaggtcacacactgcggccagatgaagaggaagtaccgtgtgtgtaacgtcacgcgccgccctgccagccatcagacatttcctttgcagcttgagaacggacaagctatggagtgcaccgtcgcccagtatttcaaacaaaagtacagcctgcagctcaaatacccccatctgccctgcctccaggtggggcaggaacaaaagcacacctacctgccccttgaggtttgtaacatagtggcgggacagcgctgtataaagaagctaaccgataaccagacctcgaccatgatcaaagctacggcccgctccgccccagacagacaggaagagatcagcagactggtcaaaagcaacagcatggtgggcgggcccgacccgtacctgaaagagttcggtatcgtggtgcacaatgacatgaccgaggtgactgggcgggtcctcccagcgcccatgcttcagtatgggggccggaacaagacggtggccacacccaaccagggtgtctgggacatgagaggaaagcagttttatgcgggtattgagatcaaggtgtgggccgtcgcctgcttcgccccgcagaaacagtgcagagaggatctgctcaagagcttcaccgaccagctgcgcaagatctccaaagatgccgggatgccgattcaaggccagccctgcttctgcaagtacgcccagggcgcagacagcgtggagcccatgttcaagcatctcaagatgtcttacgtgggactacagctcattgtggtcattctgccggggaaaacgcccgtctatgcggaggtgaagcgtgtgggagacactctgctgggaatggccactcagtgcgtgcaggtgaaaaacgtggtgaagacgtcccctcagacgctgtccaacctctgtctgaagatcaacgccaaactagggggcatcaacaatgtgctggtgccacatcagaggccctctgtgttccagcagccggtcatcttcttgggcgcagatgtcactcacccccccgcgggcgacgggaagaagccgtccattgcggcggtggtggggagcatggacggacaccccagccgctactgtgccaccgtgcgggtgcagacttcacgccaggatctgtcccaggagcagctcttcagtcaggaggtcatccaggatctcaccaacatggtgcgagagctcctcattcagttctacaagtcgacccggtttaagcccacgcgcatcatctactaccgcggaggagtttctgagggccagatgaagcaggtcgcctggccggagctgatcgccatcaggaaagcttgcatcagtctcgaagaggattacagaccgggaatcacctacatcgtagtgcagaaacgtcaccacactcgcctcttttgctctgataaagccgagagggtcgggaagagtggcaatgtcccagcaggcactacagtggacagcaccatcacacacccctcagagtttgacttctacctgtgcagccatgctggaatccagggcactagccgtccctctcactatcacgtcttgtgggatgacaactgtttcaccgccgacgaactgcagctcttgacttaccagctctgccacacctacgtgcgctgcacccgctccgtctccatcccagcgccagcctactacgcccggctcgtggcgttccgtgcccgttaccacttggtggacaaagaccatgacagttgcagctcctctcttcccagtctgtcagaaacgctctgcgctgaaggaagtcacgtatcaggacagagtaacggccgagaccctcaggccctggcgaaggcggtccagattcactatgatacccagcacactatgtacttcgcctgacgtcagccagcaggagacgcacttctacactccctcttcgatctgtctctctctctcttcctcttcctgtttctctatcgcgtcgtcgtctgcagccaagcagttctgaacccagggggccatctgtcaatccagtcgaaatcggtcggcctcggaagaaccaacctctaccagcagtcctgcactgagaggcttcctgcctccaatgcacagagaaaaaaatcaatttgagccatttttaacactttcttttcttgttttgattttgaatgtttttaatttgtaatatacactgagtgtgagcaaacctgcgccattggtcagggcagctctggctctcttagctaagctggactctgtctacttttacctcaagccgcaattggctgaatcttgtcacatgtcttttggggtggggtggggcgg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]