GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-18 13:15:48, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_061544390             285 bp    mRNA    linear   INV 15-DEC-2023
DEFINITION  PREDICTED: Musca vetustissima enhancer of split m4 protein-like
            (LOC133336092), mRNA.
ACCESSION   XM_061544390
VERSION     XM_061544390.1
DBLINK      BioProject: PRJNA1046533
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Musca vetustissima
  ORGANISM  Musca vetustissima
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Diptera; Brachycera;
            Muscomorpha; Muscoidea; Muscidae; Musca.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_026888268) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_032173495.1-RS_2023_11
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/30/2023
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..285
                     /organism="Musca vetustissima"
                     /mol_type="mRNA"
                     /isolate="MV318-11"
                     /db_xref="taxon:27455"
                     /chromosome="Unknown"
                     /sex="pooled male and female"
                     /tissue_type="whole insect"
                     /dev_stage="adult"
                     /ecotype="Yass"
                     /country="Australia: NSW, Yass"
                     /collection_date="2020-03"
     gene            1..285
                     /gene="LOC133336092"
                     /note="enhancer of split m4 protein-like; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 2 Proteins"
                     /db_xref="GeneID:133336092"
     CDS             1..285
                     /gene="LOC133336092"
                     /codon_start=1
                     /product="enhancer of split m4 protein-like"
                     /protein_id="XP_061400374.1"
                     /db_xref="GeneID:133336092"
                     /translation="
MDSTKISKLLKEIYNLQKVREAASAALLESPESLDNSLNESLESDCGSMESYENIANERISAKVYRKKEDNRPSTTSVPVYFVRSEKGTYFWTN"
ORIGIN      
atggatagcaccaaaattagcaagctgctaaaagaaatctacaatctacaaaaagtaagagaagccgcgagtgctgccttattggaatcgccggaatcattggataatagccttaatgaaagcctagaatcggattgtggatcaatggaatcctatgaaaatattgcaaatgaaagaatctcggccaaggtataccgtaaaaaggaagacaatcgtcccagtacaacttcggtaccggtttattttgttcgttcggaaaaaggcacctacttttggactaattga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]