2024-05-18 13:15:48, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_061544390 285 bp mRNA linear INV 15-DEC-2023 DEFINITION PREDICTED: Musca vetustissima enhancer of split m4 protein-like (LOC133336092), mRNA. ACCESSION XM_061544390 VERSION XM_061544390.1 DBLINK BioProject: PRJNA1046533 KEYWORDS RefSeq; includes ab initio. SOURCE Musca vetustissima ORGANISM Musca vetustissima Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Diptera; Brachycera; Muscomorpha; Muscoidea; Muscidae; Musca. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_026888268) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_032173495.1-RS_2023_11 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 11/30/2023 ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 100% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..285 /organism="Musca vetustissima" /mol_type="mRNA" /isolate="MV318-11" /db_xref="taxon:27455" /chromosome="Unknown" /sex="pooled male and female" /tissue_type="whole insect" /dev_stage="adult" /ecotype="Yass" /country="Australia: NSW, Yass" /collection_date="2020-03" gene 1..285 /gene="LOC133336092" /note="enhancer of split m4 protein-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins" /db_xref="GeneID:133336092" CDS 1..285 /gene="LOC133336092" /codon_start=1 /product="enhancer of split m4 protein-like" /protein_id="XP_061400374.1" /db_xref="GeneID:133336092" /translation="
MDSTKISKLLKEIYNLQKVREAASAALLESPESLDNSLNESLESDCGSMESYENIANERISAKVYRKKEDNRPSTTSVPVYFVRSEKGTYFWTN"
ORIGIN
atggatagcaccaaaattagcaagctgctaaaagaaatctacaatctacaaaaagtaagagaagccgcgagtgctgccttattggaatcgccggaatcattggataatagccttaatgaaagcctagaatcggattgtggatcaatggaatcctatgaaaatattgcaaatgaaagaatctcggccaaggtataccgtaaaaaggaagacaatcgtcccagtacaacttcggtaccggtttattttgttcgttcggaaaaaggcacctacttttggactaattga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]