2024-05-19 16:11:14, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_061163019 943 bp mRNA linear MAM 02-DEC-2023 DEFINITION PREDICTED: Dama dama copper chaperone for superoxide dismutase (CCS), transcript variant X3, mRNA. ACCESSION XM_061163019 VERSION XM_061163019.1 DBLINK BioProject: PRJNA1045691 KEYWORDS RefSeq. SOURCE Dama dama (fallow deer) ORGANISM Dama dama Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia; Pecora; Cervidae; Cervinae; Dama. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_083682) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_033118175.1-RS_2023_11 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 11/29/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..943 /organism="Dama dama" /mol_type="mRNA" /isolate="Ldn47" /isolation_source="Tissue" /db_xref="taxon:30532" /chromosome="2" /sex="male" /country="United Kingdom" /lat_lon="51.450387 N 0.285828 W" /collection_date="2022-02-23" gene 1..943 /gene="CCS" /note="copper chaperone for superoxide dismutase; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:133070621" CDS 95..805 /gene="CCS" /codon_start=1 /product="copper chaperone for superoxide dismutase isoform X2" /protein_id="XP_061019002.1" /db_xref="GeneID:133070621" /translation="
MASDREDRGTACTLEFAVQMTCQSCVDAVRTSLQGIAGVESVEVQLENQMVLVQTTLPSQEVQALLEGTGRQAVLKGMGSGLLQNLGAAVAILGGPGPVQGVVRFLQLTPERCLIEGTIDGLQPGLHGLHIHQFGDLTRNCNSCGDHFNPDGMSHGGPQDSERPGEGDTQNSVVAAQPEHLCRSLREALGTQSKLQIQSEGHRQWERASQRSTAETWGMSVPMRMAELSSGLRTSS"
ORIGIN
aggagtggcttccggggctccgcctccccctctccgcggcgctgctctgggctggagcttcagttccggccctcgggcgatagttggattcaggatggcgtcggaccgggaggaccgcgggactgcctgcacgctggagttcgcggtgcagatgacctgtcagagctgcgtggacgcggtgcgcacgtccctgcaagggatcgcaggtgtcgaaagtgtggaggtgcagttggagaaccagatggtcctggtgcagaccaccctgcccagccaggaggtgcaggcccttctagaaggcactgggaggcaggcggtcctcaagggcatgggcagtggcctgttgcagaatttaggggcagccgtggccattcttggggggcctggccctgtgcagggagtggtgcgcttcttgcagctgacccctgagcgctgcctaatcgaggggaccattgatggcctgcagcctgggctgcatggactccacatccatcagttcggggacctcacgaggaattgcaacagctgtggggaccactttaaccctgatggaatgtcccatgggggcccccaggactctgaacggcctggtgagggagacactcagaactccgtggttgcggcacagccagagcatctttgcaggagcctccgggaggccctgggaacccagagcaagctccagatccagtccgaagggcacaggcagtgggagagagcttcccagagaagcaccgcggagacctggggaatgtccgtgccgatgaggatggccgagctgtcttcaggattgaggacgagcagctgaaggttggcctgtggcatcatcgcacgcgccgctggccttttccagaaccccaagcagatctgctcctgcgatggcctcaccatctgggaggagcggggccggcccatcgctggccagggacggaaggagcccgcccag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]