GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-19 16:11:14, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_061163019             943 bp    mRNA    linear   MAM 02-DEC-2023
DEFINITION  PREDICTED: Dama dama copper chaperone for superoxide dismutase
            (CCS), transcript variant X3, mRNA.
ACCESSION   XM_061163019
VERSION     XM_061163019.1
DBLINK      BioProject: PRJNA1045691
KEYWORDS    RefSeq.
SOURCE      Dama dama (fallow deer)
  ORGANISM  Dama dama
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Ruminantia;
            Pecora; Cervidae; Cervinae; Dama.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_083682) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_033118175.1-RS_2023_11
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 11/29/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..943
                     /organism="Dama dama"
                     /mol_type="mRNA"
                     /isolate="Ldn47"
                     /isolation_source="Tissue"
                     /db_xref="taxon:30532"
                     /chromosome="2"
                     /sex="male"
                     /country="United Kingdom"
                     /lat_lon="51.450387 N 0.285828 W"
                     /collection_date="2022-02-23"
     gene            1..943
                     /gene="CCS"
                     /note="copper chaperone for superoxide dismutase; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon."
                     /db_xref="GeneID:133070621"
     CDS             95..805
                     /gene="CCS"
                     /codon_start=1
                     /product="copper chaperone for superoxide dismutase
                     isoform X2"
                     /protein_id="XP_061019002.1"
                     /db_xref="GeneID:133070621"
                     /translation="
MASDREDRGTACTLEFAVQMTCQSCVDAVRTSLQGIAGVESVEVQLENQMVLVQTTLPSQEVQALLEGTGRQAVLKGMGSGLLQNLGAAVAILGGPGPVQGVVRFLQLTPERCLIEGTIDGLQPGLHGLHIHQFGDLTRNCNSCGDHFNPDGMSHGGPQDSERPGEGDTQNSVVAAQPEHLCRSLREALGTQSKLQIQSEGHRQWERASQRSTAETWGMSVPMRMAELSSGLRTSS"
ORIGIN      
aggagtggcttccggggctccgcctccccctctccgcggcgctgctctgggctggagcttcagttccggccctcgggcgatagttggattcaggatggcgtcggaccgggaggaccgcgggactgcctgcacgctggagttcgcggtgcagatgacctgtcagagctgcgtggacgcggtgcgcacgtccctgcaagggatcgcaggtgtcgaaagtgtggaggtgcagttggagaaccagatggtcctggtgcagaccaccctgcccagccaggaggtgcaggcccttctagaaggcactgggaggcaggcggtcctcaagggcatgggcagtggcctgttgcagaatttaggggcagccgtggccattcttggggggcctggccctgtgcagggagtggtgcgcttcttgcagctgacccctgagcgctgcctaatcgaggggaccattgatggcctgcagcctgggctgcatggactccacatccatcagttcggggacctcacgaggaattgcaacagctgtggggaccactttaaccctgatggaatgtcccatgggggcccccaggactctgaacggcctggtgagggagacactcagaactccgtggttgcggcacagccagagcatctttgcaggagcctccgggaggccctgggaacccagagcaagctccagatccagtccgaagggcacaggcagtgggagagagcttcccagagaagcaccgcggagacctggggaatgtccgtgccgatgaggatggccgagctgtcttcaggattgaggacgagcagctgaaggttggcctgtggcatcatcgcacgcgccgctggccttttccagaaccccaagcagatctgctcctgcgatggcctcaccatctgggaggagcggggccggcccatcgctggccagggacggaaggagcccgcccag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]