2024-04-28 16:00:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_060885585 1224 bp mRNA linear VRT 08-NOV-2023 DEFINITION PREDICTED: Tachysurus vachellii vimentin-related 2 (vimr2), mRNA. ACCESSION XM_060885585 VERSION XM_060885585.1 DBLINK BioProject: PRJNA1034989 KEYWORDS RefSeq. SOURCE Tachysurus vachellii ORGANISM Tachysurus vachellii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Siluriformes; Bagridae; Tachysurus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_083472) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_030014155.1-RS_2023_11 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.2 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 11/04/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1224 /organism="Tachysurus vachellii" /mol_type="mRNA" /isolate="PV-2020" /db_xref="taxon:175792" /chromosome="13" /sex="female" /tissue_type="muscle" /dev_stage="adult" /country="China: Wuhan" gene 1..1224 /gene="vimr2" /note="vimentin-related 2; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 Proteins" /db_xref="GeneID:132856139" CDS 1..1170 /gene="vimr2" /codon_start=1 /product="glial fibrillary acidic protein" /protein_id="XP_060741568.1" /db_xref="GeneID:132856139" /translation="
MAMLRVSSYRKLFEEEHPRSTSWLSQRCGTQILSSSARTGVSMIDCPEPDFSAARALNRESLMRFSQERSIIAALNDRLAVLIDMVRCLEEENESLEAQIVEMEGRLAARPIASSSSSPDCPSYSSLEAVIERLRREKDEILCHKEELKKNLHHIKIKYEEVVEQRTQLQLERKDVAVEVDSVTADCLALREQATIYEEQLATMEQQHELSIESLCEPAAEDRDDPTVSLQFPSIDLTPAITVINDYYCQLAESLQFESRAVEIARGQEKRRNLEKLTGGKVKDNSEVMDVNGLKELIAKLQKELADLEACGEELEAETEAKKEAHLLEIEELETCICQLEKEEADLQAQMKEQMGDYEDLLNEKMALDIEIEAYRVLVEMEEERLCYP"
ORIGIN
atggccatgctgagagtgtcctcataccgcaaactctttgaggaggaacatccaagatcaacttcatggctcagccagcgctgtggaacccagatcctctcctcttctgccaggactggagtttccatgatcgactgccctgaaccggacttctctgcagctcgagctttaaacagggagagtctgatgcggttctcccaggagcgctccataatcgctgcccttaatgatcgcctggcggtccttatcgacatggtacgatgtctggaagaagaaaatgagtctttggaggctcagattgttgagatggaagggagattggcagccagaccgattgcctccagctccagcagtcccgactgcccatcatactccagcctggaggctgtgattgagagactgcgcagagagaaggacgaaattttgtgtcacaaggaggagctgaagaaaaacctgcatcatataaaaataaagtatgaagaggttgtagagcaacggactcagctccaactggagcgcaaggatgttgccgtggaggtagattcagtgactgctgactgcttggcactaagagaacaagcaacgatctatgaggagcagttagctaccatggagcaacagcatgagttgagtattgagagtctttgtgagcctgcagctgaagatcgggatgatccgaccgtatctctgcaattcccctccatcgacctcactccagccatcacggttatcaacgactattattgccagctggctgaaagcctacagtttgagtccagggctgttgagattgccagaggacaagagaagaggaggaacctggaaaaacttactggagggaaggttaaggataattctgaggtgatggacgtgaatggtctgaaggagctgattgctaaactgcaaaaggagctcgctgatctggaggcatgtggtgaggaactagaggcagagactgaagcaaaaaaagaggctcatctgctagagatagaggagctggaaacctgcatctgccagctggagaaagaagaggctgacttacaagcacagatgaaggaacagatgggggactatgaggatctgctcaatgagaagatggcactggacatagaaattgaagcctacagggttttggtggagatggaggaggagagattgtgctacccttaagacatacaatatcttgtgtattgctgctgaactaacagacttacatcaaattgc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]