GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-07-04 11:11:00, GGRNA.v2 : RefSeq release 229 (Mar, 2025)

LOCUS       XM_060120690            3317 bp    mRNA    linear   MAM 07-OCT-2023
DEFINITION  PREDICTED: Lagenorhynchus albirostris NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X4,
            mRNA.
ACCESSION   XM_060120690
VERSION     XM_060120690.1
DBLINK      BioProject: PRJNA1023191
KEYWORDS    RefSeq.
SOURCE      Lagenorhynchus albirostris (white-beaked dolphin)
  ORGANISM  Lagenorhynchus albirostris
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Whippomorpha;
            Cetacea; Odontoceti; Delphinidae; Lagenorhynchus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_083095) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_949774975.1-RS_2023_10
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 10/05/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3317
                     /organism="Lagenorhynchus albirostris"
                     /mol_type="mRNA"
                     /db_xref="taxon:27610"
                     /chromosome="1"
     gene            1..3317
                     /gene="NRDE2"
                     /note="NRDE-2, necessary for RNA interference, domain
                     containing; Derived by automated computational analysis
                     using gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins"
                     /db_xref="GeneID:132532323"
     CDS             21..3188
                     /gene="NRDE2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2 isoform X2"
                     /protein_id="XP_059976673.1"
                     /db_xref="GeneID:132532323"
                     /translation="
MALFPAFAGVSEEPESGSPRKELDWLSNPSFCVETITSLSQQTEEVTAFVSEELLLTRSPLNSEPSDESDTNKKPKQTSRKKKKEKKKKRKHQHHKKTKRKRGQSSSSGSESYTDSEKDISSRSIRSSKKESEKPNQENNATADIGRHFVWLEDIQALTGETFRTDKKPDPANWEYKSLYRGDVARYKRKGDSCLGINPRKQCISWEGTSTEKKRSHKHVERYFTKKSVGLMNIDGVAISSKTEPPSSESISFIPVKGAEDVVSPVTTWLNPLGIYDEATTQWLQGRGPSEQESKQPDSQPNRDNVLLKAKVEEFNRRVWENPRDIQLWMAFVAFQDEVMRSPGLYAIEEGQQEKRKRSLKLVLEKKLAILERAVESNPSSVDLKLAKLQLCTEFWEPSTLVKEWQKLIFLHPNNTALWQKYLLFCQSQFSTFSISKIQSLYGKCLSTLSAVKDGSILSHPELPGTEEAMFALFLQQCHFLRQAGHSEKAVSLFQAMVDFTFFKPDSVKDLPTKGQVEFFEPFWDSGEPRAGEKGARGWRAWMQQQERGGWVVVSPDDDDDEPEDDDQEIKDKTLPRWQIWLAAERSRDHRHWRPWRPEKTKKQAEEDCEDPERQVLFDDIGQSLIQLSSPDLQFRLIAAFLQFLGVPSGFSPPASCLYLAMDENSIFDNGLYDEKPLTFLNLSFSGVSCVGRTDQLGCRHWTRGHSREGEEFIRSIFHLVMPLFSGKERSQLCFSWLRYEIAKVVWCLRTKNKKRLKSQGKNCKKLAKNLLKEPDNRNNFCLWKQYAHLEWLLGNTEDARRVFDTALGMAGSRELKDHELCELGLLYAELEVELLPDVRGAAPARAIHVLTRLTENGAYGPYTGQVLAVHILKARKAYEHALQDCLGENCVSDPAPADSFSRLISLVKCFMLFQYLTIGIDAAVRIYEQVFAKHKVSVSAEGPGLEGSASPPSLSSVLEAVTLMHTSLLRFHMKVAVYPLAPLREALSEALKLYPGNQVLWRSYVQIQNKSHSASKTRRFFDAITRSAKPLEPWLFAIEAEKMRKRLVETVQRW"
ORIGIN      
aggcggtgtggcctgtgaacatggcgctgttccccgcctttgcgggtgttagtgaggagcccgaaagcgggagccccaggaaagaattagactggctgagcaacccaagcttttgtgttgaaaccataacatctctgagccaacaaactgaagaggtcacagcctttgtttctgaagagttgctactgaccaggagtcctctgaattcagagccttcagatgaaagtgacactaacaaaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcagcaccacaagaaaaccaagagaaaacgtgggcagtcaagtagcagtggatctgagtcatatactgattctgaaaaagacatatcttccagaagcatcagaagcagtaaaaaggaatcagagaaaccgaatcaagaaaataatgccactgctgatattggacgtcactttgtttggcttgaggacattcaggctctgacgggagaaaccttcagaacagataagaagccggatcctgcaaactgggagtataagtctctttaccgaggagatgtagcaagatacaagaggaaaggagactcctgccttggcattaaccctaggaagcagtgtatatcttgggaggggacttccacagaaaagaagcggtcacacaagcatgtcgagcgctactttacaaagaagagcgtgggattaatgaacattgacggagttgccattagcagtaaaactgaacctccctcatcagagtcgatctcatttatcccagtgaagggtgcagaggatgtggtttcccctgttacaacctggttgaaccctctggggatttatgatgaagccaccacgcagtggttacaaggccggggtccttcagagcaagaatccaagcagccagattcacagcccaacagagacaacgtgcttctcaaggccaaggtggaggagtttaacaggagggtttgggagaatcctcgggacattcagctgtggatggcatttgttgcttttcaggacgaggtcatgaggagtccgggcctgtatgccatcgaggaaggacagcaggaaaagcggaagcggtccctgaagctggttctggagaagaagctggccattctggaacgggccgtggaaagcaacccgagcagcgtggatctgaaacttgccaagctgcagctctgcaccgagttctgggagccctccactctggtcaaagagtggcagaaactgatatttttacatcccaacaatacagccctttggcagaaataccttttattttgccagagccagtttagcaccttttccatatcaaaaattcagagtctttatggaaaatgcttgagtactttgtctgctgttaaggacggcagcatcttgtctcaccctgagctgcctggcactgaggaggccatgtttgccctctttcttcagcagtgccactttctgcgtcaggctggtcactccgagaaggctgtctctctgttccaggccatggttgacttcaccttcttcaaacccgacagtgtgaaagacctgcctaccaaaggacaggtagaattctttgagcccttttgggacagtggagagcccagggccggggagaagggcgcccgaggctggagagcgtggatgcagcagcaggagcggggcggctgggtggtcgtcagcccagatgatgacgatgatgaaccagaagacgacgaccaggaaattaaagataagactctgcccaggtggcagatctggcttgctgctgagcggtcccgagaccacagacactggaggccgtggcgccctgagaagaccaagaagcaggcggaggaagactgtgaggacccggagaggcaggtgttgtttgatgatattggacagtctctgatccagctttccagcccggatcttcagtttcggctgattgcagcctttctgcagttcttgggtgtgccttccggcttcagccctccggcctcctgcctctatctggccatggatgagaacagcatctttgacaatggactttatgatgaaaagcccttgacttttctcaacctttcattttccggcgtcagctgtgtcggacgcacagaccagctgggttgccggcactggaccaggggtcacagtcgagagggcgaggagttcatccgcagcatcttccacctcgtgatgcctttgttttcaggcaaggagaggtctcagctctgcttctcctggttacggtacgagattgcaaaggtcgtttggtgtctgcgcactaaaaacaagaagagattaaaatcacaaggaaagaactgcaaaaaactagccaagaatctcctcaaggagccagacaaccgcaacaatttttgcctctggaagcagtatgcgcatctggagtggttgctcggcaacacagaggatgccagaagagttttcgatacagcactcggcatggcagggagcagagaactgaaggaccatgagctgtgtgagctcggtctcctctatgccgagctggaggtggagctgttgccggacgtgagaggggctgccccagcccgagccattcacgtattgaccagactgaccgagaatggggcctacgggccctacactgggcaagtcttggccgttcacattttgaaagctcggaaggcttatgaacacgcgctgcaggactgtttgggggagaactgtgtctctgatccagctcccgccgattcctttagccgcctgattagcctggttaaatgcttcatgctcttccagtatttgaccatagggatcgacgctgctgtgcggatatatgagcaggtatttgcgaaacacaaggtctctgtttccgcagagggccctggtctggagggcagtgccagccccccgagcctgagcagtgtccttgaggccgtcaccctgatgcacacgagcctgcttagattccacatgaaagtcgccgtctaccctctggctcctctgcgagaggctctctcggaggctttaaagttgtatccgggcaaccaggttctttggaggtcgtatgtacagattcagaataagtcccacagtgccagtaagaccagaagattcttcgatgcgatcaccaggtctgccaaacccttggagccgtggttgttcgcaattgaagctgagaaaatgaggaaaagactagtggaaactgtgcagagatggtagagaggtctacgccaccattcccgagaccggcctgacacatcggatcagagccctgtttgaaaatgcgatgcggagtgactacggcagccagtgccccttactgtggaggatgtatttgaattttttggt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]