2024-05-20 11:19:46, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_058859894 1163 bp mRNA linear VRT 14-AUG-2023 DEFINITION PREDICTED: Poecile atricapillus biliverdin reductase B (BLVRB), mRNA. ACCESSION XM_058859894 VERSION XM_058859894.1 DBLINK BioProject: PRJNA1004590 KEYWORDS RefSeq. SOURCE Poecile atricapillus (Black-capped chickadee) ORGANISM Poecile atricapillus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Passeriformes; Paridae; Poecile. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_081279) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_030490865.1-RS_2023_08 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 08/11/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1163 /organism="Poecile atricapillus" /mol_type="mRNA" /isolate="bPoeAtr1" /db_xref="taxon:48891" /chromosome="31" /sex="female" /tissue_type="blood" /dev_stage="adult" /country="USA: Rockefeller University Field Research Center, Millbrook, New York" /lat_lon="41.767983 N 73.750862 W" /collection_date="2018-05-18" /collected_by="Jean-Nicolas Audet" gene 1..1163 /gene="BLVRB" /note="biliverdin reductase B; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 9 Proteins" /db_xref="GeneID:131590052" CDS 16..1095 /gene="BLVRB" /codon_start=1 /product="flavin reductase (NADPH)" /protein_id="XP_058715877.1" /db_xref="GeneID:131590052" /translation="
MKTGIGIKPGPESNRDRDKTGTGTKPGLGSNRDRDWDKTGTGIKPGPGQNRDRNKTGIGISWIGISWIWIPRSGAAAPERCEPRRSRPARGSLPVPPSPSQFPPSPSQFPPSPARGRGQNSPVRSRSRFRSRFDPDPGPGSVRSRFGVRRMKKIAIFGATGRTGRVTLGLALEQGLEVTVLVRDPSRLPPGPSPTRLLQGDARDPRAVGEALRGQEGVLILLGTGTDLSPTTVMSDATKTIVEAMAEHGVPKVVVCLSAFLLWEPERVPERLRPLTEDHSRMERILRHSGLRCVYVMPPHIAVEQPLTGDYEVSVGVAGGPGSSRQISALDLGHFMLRCLRSDEFDGKSVYVSRHYPKE"
misc_feature 472..1071 /gene="BLVRB" /note="biliverdin IX beta reductase (BVR-B, aka flavin reductase)-like proteins; atypical (a) SDRs; Region: BVR-B_like_SDR_a; cd05244" /db_xref="CDD:187555" misc_feature order(487..489,493..504,562..564,574..576,619..621, 676..684,712..717,781..789,850..852,907..915) /gene="BLVRB" /note="NAD binding site [chemical binding]; other site" /db_xref="CDD:187555" misc_feature order(688..693,787..795,802..804,829..831,838..843, 850..852,907..915,988..990) /gene="BLVRB" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:187555" misc_feature order(715..717,787..789,838..840,850..852) /gene="BLVRB" /note="putative active site [active]" /db_xref="CDD:187555" ORIGIN
aaaaccgggaccgggatgaaaaccgggattgggataaaaccaggaccggaatcaaaccgggaccgggacaaaaccgggaccggaacaaaaccgggactaggatcaaaccgggatcgggactgggataaaaccgggaccggaatcaaaccgggaccgggacaaaaccgggaccggaacaaaaccgggatcgggatctcatggatcgggatctcatggatttggatcccgcggtccggggcggctgcaccggaacgatgcgaaccgaggcggtcccgccccgcccgggggtccctcccagtccctcccagtccctcccagttccctcccagtccctcccagttccctcccagtcccgcccgggggcgcggccaaaactccccggttcgatcccggtcccggttccggtcccggttcgaccccgatcccggtcccggttcggtccggtcccggttcggggtgaggaggatgaagaagatcgcgattttcggggccaccggcagaaccgggcgggtcacgctggggctggcgctggagcaggggctggaggtgaccgtcctggtccgggacccctcgcggctgccccccggcccctcccccacgcggctgctgcagggggacgcgcgggacccccgggcggtgggggaggccctgaggggccaggagggggtcctgatcctgctgggcaccggaaccgacctcagccccaccacggtcatgtccgacgccaccaaaaccatcgtggaggccatggctgagcacggcgtgcccaaggtggtggtgtgtctgtccgcgttcctgctgtgggagcccgagcgcgttcccgagcggctgcggccgctgaccgaggatcattcccgcatggagcggatcctgcggcactcggggctgcgctgcgtctacgtcatgcccccgcacatcgccgtggagcagccgctcaccggggattacgaggtctcggtgggcgtggcgggcgggccgggatcctcccggcagatctcggcgctggatctcggacacttcatgctccgctgcctccggagcgacgagttcgacgggaagagcgtctacgtcagccgccactaccccaaggagtagggatccacttccgccaggatccgccaccgggatccacccccgggatccgcccccgggatccatccccg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]