GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-06 11:52:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_056141410            2834 bp    mRNA    linear   INV 18-MAY-2023
DEFINITION  PREDICTED: Ostrea edulis protein argonaute-2-like (LOC125683714),
            transcript variant X10, mRNA.
ACCESSION   XM_056141410
VERSION     XM_056141410.1
DBLINK      BioProject: PRJNA970818
KEYWORDS    RefSeq.
SOURCE      Ostrea edulis
  ORGANISM  Ostrea edulis
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Bivalvia;
            Autobranchia; Pteriomorphia; Ostreida; Ostreoidea; Ostreidae;
            Ostrea.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_079169) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_947568905.1-RS_2023_05
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 05/10/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2834
                     /organism="Ostrea edulis"
                     /mol_type="mRNA"
                     /db_xref="taxon:37623"
                     /chromosome="6"
     gene            1..2834
                     /gene="LOC125683714"
                     /note="protein argonaute-2-like; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 86
                     long SRA reads"
                     /db_xref="GeneID:125683714"
     CDS             120..2819
                     /gene="LOC125683714"
                     /codon_start=1
                     /product="protein argonaute-2-like isoform X10"
                     /protein_id="XP_055997385.1"
                     /db_xref="GeneID:125683714"
                     /translation="
MFPIAPGSTPLSFGPFTTVPPPEPPPHPADQPPPTPIPPSNGNAGEFVCPLRPDHGREGKPIALRANHFHVNIPKGFIHHYNIAIVPEKCPRRVNREIVETMVNAYTPRIFSGQKPVFDGREKMYSREPLPFGKDKVELEVTLPGEGRDRVFKVAIKWVSQISLYALEEALEGRARRIPECAVEALDVIMRHLPSMMYTPVGRSFFSPPEDYDYPLGGGREVWFGFHQSVRPSHWKMMLNIDVSATAFYKAQPVIDFMCEILELKDANEQRRPLTDSQRVKFTKEIRNLKVEITHCGTMRRKYRVCNVTRRPAQTQSFPLQLDSGQTVDCTVARYFLERYKMKLLHPHLPCLQVGQEHKHTYLPLEVCNVVGGQRCIKKLTDLQTSTMIRATAKNAPDREKEINNLVKKANYNADPHLRTFGITVNPQMMDLHGRVLSHPKLQYGGAVSAGRESDKETKAQALPNQGVWDMRGKQFYFGIEVRVWAIACFAPQRSVREDALRNFTQQLQKISTDAGMPILGQPCFCKYATGPDQVEPMFRYLKNTYAGLQLIVVVLPGRTPVYAEVKRVGDILFGLATQCVQSKNVNKTSPQTLSNLCLKINVKLGGINNILLPSSRPLVFREPVIFLGADVTHPPAGDTSKPSIAAVVGSMDAHPSRYSATVRVQEHRKEVIEEFCSMVRELLISFYKSTQFKPTRIIIYRDGVSEGQFQKVLAHELRAVREACMKLEIGYQPGITFIAVQKRHHTRLFCADRKDQIGRSGNIPAGTTVDVGITHPTEFDFYLCSHAGIQGTSRPSHYHVLFYLQGTSRPSHYHVLFYLQGTSRPSHYHVLFYLQGTSRPSHYLVLFYLQGTSRPSYYHVLLYLQGTSRPSHYHVLLYLQGTSRPSHYHVLLYLQGTS"
     misc_feature    297..689
                     /gene="LOC125683714"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    717..869
                     /gene="LOC125683714"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    870..1232
                     /gene="LOC125683714"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1026..1028,1071..1073,1113..1115,1125..1127,
                     1179..1181,1200..1202,1206..1208)
                     /gene="LOC125683714"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1365..2525
                     /gene="LOC125683714"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1806..1808,1818..1820,1854..1865,1872..1874,
                     1896..1898,1905..1907,1917..1919,1929..1931)
                     /gene="LOC125683714"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
ORIGIN      
gcacagaagatcaccaagaaagagtgcgccatgttttattttttgacaaaaagatggaaatgacagaactttgtttacgtcttctgatttaccatttcccttcgtcataagatgtcataatgtttcccatagcaccagggtccaccccgctttcctttggtccgttcaccacagtccctccacctgaaccaccaccccaccctgctgaccagccacccccaaccccaataccaccatccaatggaaatgcaggagaatttgtctgtcccctcaggccagaccatggacgggagggaaagcctattgctctccgagcaaatcatttccatgtcaacatccctaaggggttcatccaccactacaacattgcaattgtacctgagaaatgtcccaggagggtcaacagagagatagtagagacaatggtgaatgcctacacacccagaattttctcaggacaaaagcctgtttttgatggcagagagaaaatgtacagccgggaaccactcccgtttggcaaagacaaggtggaacttgaggtcactctgccaggagaggggcgtgaccgcgtgttcaaggttgccattaagtgggtatcacagataagtctgtacgccctggaggaggccttagagggacgcgcacggagaatccccgagtgtgcggtggaagccctcgatgtcatcatgagacacctacccagcatgatgtacacccctgttgggcggtcctttttctcacccccagaggactatgactacccactaggagggggtcgggaggtctggtttggcttccatcagagtgttcgtccctcccactggaaaatgatgctgaatattgatgtgtcagcgacagctttttataaagcccagccagtcatagacttcatgtgtgagattttggagctgaaggatgccaacgaacagaggcgacctctgacagattcacaaagagttaaattcaccaaggaaattagaaatttgaaggtagagatcacacactgtggaaccatgaggagaaaataccgtgtgtgtaatgttacccgccgtcctgctcaaactcagtcatttccgctccagctcgactcgggacagacggttgattgtacggtagccaggtactttctggagcggtacaagatgaaattgctgcatccccacttgccatgtctacaagttggacaagaacataagcacacatatcttcctttagaggtttgtaatgttgttggaggtcaaagatgtataaagaaattgacagatcttcaaacatccaccatgatcagggcaacagcaaagaatgctcctgacagagaaaaagaaatcaataatttggttaaaaaagcaaattacaatgctgatccccacctgaggacgttcggaatcacggtcaacccccaaatgatggacctacacggtcgcgttctgtctcatcccaagctacaatatggaggcgcggttagtgcaggacgggagtctgataaagagactaaagcccaagctctgccaaaccagggggtatgggatatgagggggaagcagttctacttcgggattgaggtgcgagtgtgggccattgcatgctttgcccctcagaggagtgttagggaagatgcactgagaaattttacccagcagttacagaaaatttctacagatgcaggaatgcccattttgggccagccctgtttctgcaaatatgccactgggccagaccaagtggaaccaatgtttcgttacctgaagaacacatatgctgggctacagctcattgtggtggttctaccaggcagaacaccagtttacgctgaggttaagcgagtaggagacatcttgtttggcttagctacacagtgcgtgcagtccaaaaatgtaaacaaaacgtctccccagacgctctccaacctctgcctgaaaattaacgtcaagttaggcggcatcaacaatatcctactgccaagttccagacccctggtgtttcgagaaccagtgattttcctcggagcagacgtgactcatccccctgctggagacacaagcaaaccttccatagcagctgtggtaggtagtatggatgcccaccccagtcgttactctgcaactgtcagggtccaggaacaccgtaaggaggtgatcgaggagttctgctcaatggtccgtgaacttctcatctccttctacaagtccacacaattcaagccaacccgcatcatcatttacagggatggcgtcagcgaagggcagtttcaaaaggtacttgcacatgagctgagagcagtaagggaggcttgtatgaagctggagataggttaccagcccgggataaccttcattgctgtccagaaacggcaccacaccagactcttttgtgccgataggaaggaccagatagggcgcagtgggaacatcccagcaggaaccacagtggatgttgggatcacacaccccacagaattcgacttttacctatgcagtcacgctggaatacagggcacaagtcgaccgtctcattaccatgtgttgttttatttacagggcacaagtcgaccgtctcattaccatgtgttgttttatttacagggcacaagtcgaccgtctcattaccatgtgttgttttatttacagggcacaagtcgaccgtctcattaccttgtgttgttttatttacagggcacaagtcgaccgtcttattaccatgtgttgttatatttacagggcacaagtcgaccgtctcattaccatgtgttgttatatttacagggcacaagtcgaccgtctcattaccatgtgttgttatatttacagggcacaagttgaccgtctcattacctt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]