LOCUS       XM_054915645             429 bp    mRNA    linear   INV 04-APR-2023
DEFINITION  PREDICTED: Lytechinus pictus uncharacterized LOC129279538
            (LOC129279538), mRNA.
ACCESSION   XM_054915645
VERSION     XM_054915645.1
DBLINK      BioProject: PRJNA889359
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Lytechinus pictus (painted urchin)
  ORGANISM  Lytechinus pictus
            Eukaryota; Metazoa; Echinodermata; Eleutherozoa; Echinozoa;
            Echinoidea; Euechinoidea; Echinacea; Temnopleuroida;
            Toxopneustidae; Lytechinus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_067095) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_015342785.2-RS_2023_03
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 03/31/2023
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..429
                     /organism="Lytechinus pictus"
                     /mol_type="mRNA"
                     /isolate="DCL-2020"
                     /isolation_source="California coast"
                     /db_xref="taxon:7653"
                     /chromosome="2"
                     /sex="male"
                     /tissue_type="sperm"
                     /country="USA: California"
                     /collection_date="2019-01-01"
     gene            1..429
                     /gene="LOC129279538"
                     /note="uncharacterized LOC129279538; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 6
                     Proteins"
                     /db_xref="GeneID:129279538"
     CDS             1..429
                     /gene="LOC129279538"
                     /codon_start=1
                     /product="uncharacterized protein LOC129279538"
                     /protein_id="XP_054771620.1"
                     /db_xref="GeneID:129279538"
                     /translation="

MHPANQEEIVLVQDTQPMEDEAPNTKKARFVFKGKTEAPAKQTVGEFVEEARRESAGTTHAARPTPTGANVLQVKICQGVKPKNVTVRKFGGCVYVDIREFYLLGGQTHPTKKGITLSEMDFKKLQMSLKQINATIYKAKNM"

     misc_feature    247..375
                     /gene="LOC129279538"
                     /note="Transcriptional Coactivator p15 (PC4); Region: PC4;
                     pfam02229"
                     /db_xref="CDD:426669"
ORIGIN      

atgcacccagcgaaccaagaagagattgtgctcgtccaagatacccagccgatggaagacgaagccccaaacacgaagaaggcaaggtttgtcttcaagggaaagacggaggcaccagcaaagcagaccgtgggagagtttgtggaggaggcgaggagagaatcggctgggacaacgcatgcagcaagaccaacaccgactggcgccaacgtactacaggttaaaatatgccagggtgtgaagcccaaaaatgtaactgtcagaaagtttggtgggtgcgtctacgtggacattcgagaattctacctgctaggaggtcaaacgcaccccacaaaaaaaggcatcaccttgtcagaaatggactttaagaagctacagatgtcgttgaagcagattaacgccacaatttacaaggccaagaacatgtag

//