2024-05-06 17:28:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_054905513 621 bp mRNA linear INV 04-APR-2023 DEFINITION PREDICTED: Lytechinus pictus germ cell nuclear acidic protein-like (LOC129267897), mRNA. ACCESSION XM_054905513 VERSION XM_054905513.1 DBLINK BioProject: PRJNA889359 KEYWORDS RefSeq; includes ab initio. SOURCE Lytechinus pictus (painted urchin) ORGANISM Lytechinus pictus Eukaryota; Metazoa; Echinodermata; Eleutherozoa; Echinozoa; Echinoidea; Euechinoidea; Echinacea; Temnopleuroida; Toxopneustidae; Lytechinus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_067102) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_015342785.2-RS_2023_03 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 03/31/2023 ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 100% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..621 /organism="Lytechinus pictus" /mol_type="mRNA" /isolate="DCL-2020" /isolation_source="California coast" /db_xref="taxon:7653" /chromosome="9" /sex="male" /tissue_type="sperm" /country="USA: California" /collection_date="2019-01-01" gene 1..621 /gene="LOC129267897" /note="germ cell nuclear acidic protein-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins" /db_xref="GeneID:129267897" CDS 1..621 /gene="LOC129267897" /codon_start=1 /product="germ cell nuclear acidic protein-like" /protein_id="XP_054761488.1" /db_xref="GeneID:129267897" /translation="
MIKVTSEGECGKASKQATSCDGPKHPYHTIETDESSDDTEDDEGTPVESLERRPSKRRTVRDHETPYHTIETDKSSDDTGDDDETTVESVETRPSKRRTVTDRSTPYYTIETDESSDTEDDEGDNCGECGKASNSDDIEDDEETTEESVAEESCDDTDDDKVTSEESVERRPIKRRAVTDRNTPYHTTETDESCDDTEDDDDERDT"
ORIGIN
atgataaaggtgacatctgagggagagtgtggaaaggcgtccaagcaagcgacgagctgtgacggaccgaaacacccataccacaccatagagacggatgaaagcagtgatgacactgaggatgatgaggggacacctgtggagagtttggaaaggcgtccaagtaagcgacgaactgtgagggaccatgaaacaccataccacaccatagagacggataaaagcagtgatgacactggggatgatgatgagacaactgtggagagcgtggaaacgcgtccaagtaagcgacgaactgtgacggaccgaagcacaccatactacaccatagagacggatgaaagcagtgacactgaggatgatgagggagacaactgtggagagtgtggaaaggcgtccaacagcgatgatattgaagatgatgaggagacaaccgaagagagcgttgcggaagaaagctgtgatgatactgacgatgataaggtgacatctgaggagagtgtggaaaggcgtccaatcaagcgacgagctgtgacggaccgaaacacaccataccacaccacagagacggatgaaagctgtgatgacactgaagatgatgatgatgagagggacacctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]