2024-04-29 13:50:02, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_054040719 1395 bp mRNA linear VRT 06-MAR-2023 DEFINITION PREDICTED: Malaclemys terrapin pileata zinc finger and SCAN domain-containing protein 32-like (LOC128843686), mRNA. ACCESSION XM_054040719 VERSION XM_054040719.1 DBLINK BioProject: PRJNA938469 KEYWORDS RefSeq. SOURCE Malaclemys terrapin pileata ORGANISM Malaclemys terrapin pileata Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira; Testudinoidea; Emydidae; Malaclemys. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_071513) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_027887155.1-RS_2023_03 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 03/02/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1395 /organism="Malaclemys terrapin pileata" /mol_type="mRNA" /isolate="rMalTer1" /sub_species="pileata" /db_xref="taxon:2991368" /chromosome="9" /sex="male" /tissue_type="blood" /dev_stage="juvenile" /country="USA: Alabama" /lat_lon="30.343790 N 88.131310 W" /collection_date="2021-04-10" /collected_by="Iwo Gross" gene 1..1395 /gene="LOC128843686" /note="zinc finger and SCAN domain-containing protein 32-like; Derived by automated computational analysis using gene prediction method: Gnomon." /db_xref="GeneID:128843686" CDS 481..930 /gene="LOC128843686" /codon_start=1 /product="zinc finger and SCAN domain-containing protein 32-like" /protein_id="XP_053896694.1" /db_xref="GeneID:128843686" /translation="
MKDRGHNRDAKQCHVKIKELRQAYQKNREAKGHSRSEPQTCRFYDELHAMLGGAATSTPTLCFDSINGESRNTEAGFGDEEDDDEDNEESSQQGSGETSFPNSQDMFFTLDLEPVTPEPTQGVLLDSEGREGTSAANVSPSQRLAKIRR"
misc_feature <481..618 /gene="LOC128843686" /note="Myb/SANT-like DNA-binding domain; Region: Myb_DNA-bind_4; pfam13837" /db_xref="CDD:433516" ORIGIN
ttaagcctggacccgtccacatgacgaagctctttttttcgacttaaagggttctttaaatcgatttctttactccacctccgactaggggattagtgctgaaatcagccttgccaggatgaatttggggtagtgtggacgcaattcgacggtattggcctcctggagctatcccagagtgctccattgtgaccgctctggacagcgctctcaactcagatgcactggccaggtagacaggaaaaggcccgtgaacttttgaatctcatttcctgtttagccagcatggcaaggtgcaggtgagtgcagatttcatcagcagaggtgaccatgatggagtcccaggatcacaaaagagctccagcatggaccgaatgggaggtatgggatctgctcaccatatggggagacgaatccatgctagctgaactccattccagtaaatgaaatgccaaaacatttgaaaaagtctcaaagggcatgaaggacagaggccataacagggacgcaaagcagtgccacgtgaaaattaaggagctaaggcaagcctaccaaaaaaacagagaggcaaagggccactccagatcagagccccaaacatgccgcttctatgatgagctgcatgccatgttagggggtgcagccaccagtaccccaaccctgtgctttgactccatcaatggagaatcacgcaacacagaagcgggttttggggacgaggaagatgatgatgaagacaatgaagagagctcacagcaaggaagcggagaaaccagtttccccaacagccaagatatgtttttcaccctggacctggagccagtaacccccgaacccacccaaggtgtgctcctggactctgaaggcagagaagggacctctgctgcaaatgtttctccttcgcagaggctagcaaagattagaaggtgaaaaaaacgcactcgggatgaaatgttctctgagctcctgctgtcctcccacattgacagagcacagaagaatgcgtggaggcagacaatatcagagtgcaggaaagcacaatatgaacgcaagaagagattgtgggctgaagagagtaagtggcgggctgaagatgataggtggcatcagcttgctgacagaaggcaagagtcgatgctcagactgctggaagatcaaactcatatgctccagcgtatggttgagctgcaggaaaggcagcaggagcacagactgccactacagcccctgtgtaaccaatagccctcctccccaagttccatagcctcctcacccagatgcccaagaacgcggtggggaggcctctggccacccagccactccaccccagaggatttcccaagcaacagaaggctggccttcaataagtttttaagttttaaagtgaagtgtggc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]