LOCUS       XM_052085648            1678 bp    mRNA    linear   VRT 26-FEB-2023
DEFINITION  PREDICTED: Hippocampus zosterae dicer 1, ribonuclease type III
            (dicer1), transcript variant X3, mRNA.
ACCESSION   XM_052085648
VERSION     XM_052085648.1
DBLINK      BioProject: PRJNA867090
KEYWORDS    RefSeq.
SOURCE      Hippocampus zosterae (dwarf seahorse)
  ORGANISM  Hippocampus zosterae
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Syngnathiaria; Syngnathiformes; Syngnathoidei;
            Syngnathidae; Hippocampus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_067464) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_025434085.1-RS_2023_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/25/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1678
                     /organism="Hippocampus zosterae"
                     /mol_type="mRNA"
                     /strain="Florida"
                     /db_xref="taxon:109293"
                     /chromosome="14"
                     /sex="male"
                     /tissue_type="body"
                     /dev_stage="adult"
     gene            1..1678
                     /gene="dicer1"
                     /note="dicer 1, ribonuclease type III; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 2 Proteins"
                     /db_xref="GeneID:127614379"
     CDS             329..1678
                     /gene="dicer1"
                     /codon_start=1
                     /product="endoribonuclease Dicer isoform X2"
                     /protein_id="XP_051941608.1"
                     /db_xref="GeneID:127614379"
                     /translation="

MAGLKLVTPATSPMGPFFGLPWQQEAIHDNIYTPRKYQVELLEAALEHNTIVCLNTGSGKTFIAVLLTKELSHQIRGQYQEDAKRTVFLVNSALAVVQQAAAVRTHSDLQVGEYSDVEETSTWTYHQWSEKIIKQQVLVMTCHIFLHILRNQILPLTKINLLVFDDCHLAITNHPYCEIMKLFDGSLCSPRILGLTASILNGKCNPSDLEQKIQNLEQVLKSSAETATDLVVLDRYASQPREVVLDCGPYLDKSGLSSRLQVELDEALDFLNDCTISVAREDRGPTVVPRQVLSDCRAVLQVLGPWCADKAAGIMVRELQKYIKHEQGELNRKFLLFTDTILRKVHALCEEHFSPASLDLKFVTPKVLRLLEILHEYKPFERQQFESVEWYNNRNQDNYVSWSDSEEEDEDEEVETKDRGEANFPSPFTNILCGIIFVERRYTAVVLNR"

     misc_feature    422..1015
                     /gene="dicer1"
                     /note="DEXH-box helicase domain of endoribonuclease Dicer;
                     Region: DEXHc_dicer; cd18034"
                     /db_xref="CDD:350792"
     misc_feature    order(422..433,440..442,491..514,635..637,824..826,
                     917..919)
                     /gene="dicer1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350792"
     misc_feature    order(599..604,671..676,749..751,755..760,767..769,
                     842..850)
                     /gene="dicer1"
                     /note="nucleic acid binding site [nucleotide binding];
                     other site"
                     /db_xref="CDD:350792"
     misc_feature    1115..1393
                     /gene="dicer1"
                     /note="Partner-binding domain of the endoribonuclease
                     Dicer; Region: Dicer_PBD; cd15903"
                     /db_xref="CDD:277191"
     misc_feature    order(1124..1129,1136..1138,1142..1147,1322..1327,
                     1334..1339,1346..1348,1355..1360,1367..1369)
                     /gene="dicer1"
                     /note="Trbp binding interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:277191"
     misc_feature    1607..>1675
                     /gene="dicer1"
                     /note="Members of the P-loop NTPase domain superfamily are
                     characterized by a conserved nucleotide phosphate-binding
                     motif, also referred to as the Walker A motif
                     (GxxxxGK[S/T], where x is any residue), and the Walker B
                     motif (hhhh[D/E], where h is a...; Region: P-loop
                     containing Nucleoside Triphosphate Hydrolases; cl38936"
                     /db_xref="CDD:476819"
ORIGIN      

ttacgcaatttacgttcatgtttggtcgtagctaaggagcaggtcacaggaaatgatacatgagtgggaaaggggacacataaattgggacagtagcgtgaatgagagacgttttcaaataaaatattctggatcaacaggacatgtcacaggtgtgttcatggaagagtaaggcattaagagatttaatcatggaaccaagattaagtgtttcctaatccagattgtgttccagactttgaatttgtggaaaatccgatatgaaatgaaataaaataaagtggacagcgggaggagttctgcccattattctccatctcgttgaaaaatggctggcctgaagcttgtcaccccggccacatctcccatggggcctttttttggacttccatggcagcaggaggctattcacgataatatctatacacccagaaaatatcaggttgaacttcttgaagcagctcttgaacataacactattgtctgcttaaatactggctcaggaaagacatttattgctgttctcttaacaaaggagctctcccaccaaattcgcggacaatatcaagaggatgcgaagagaactgtgtttcttgtcaactcagccttggctgttgttcagcaagcagctgcagtcagaactcactctgacctccaagtgggagagtactcagacgtggaagagacttcaacgtggacttaccatcagtggagtgaaaagataatcaagcaacaggtgctggtaatgacttgccatatattcctgcatatactgaggaatcaaatcttacccttgacaaaaatcaacttgttggtttttgacgattgtcatcttgccatcaccaatcacccctactgtgagataatgaagctttttgatggcagtttatgcagtcctcgtattctgggtctcacagcctccattctgaatggaaagtgtaacccatcagatcttgagcagaaaatccagaatttggagcaagtcctgaaaagcagcgcagaaactgccactgaccttgtagttcttgacagatatgcctctcagccaagagaggttgtgctggactgtggcccctatctggataaaagtgggctctcctctcgtctacaagtggagttagatgaagctctcgacttcttgaatgattgtaccatttctgttgcaagagaagacaggggtccgacagtcgtccctcggcaggtcttaagtgactgcagggctgtactgcaggtgctggggccctggtgtgcagacaaagcagcaggcatcatggtgcgtgagctccagaagtatatcaagcatgaacagggggagcttaaccgcaagtttctgctcttcaccgacaccattctcagaaaagttcatgccctctgtgaagaacatttctctcctgcctccttggacctcaagtttgtcacaccaaaggttctccgtctgttggaaatcctgcatgaatacaagccttttgagaggcaacagtttgagagtgtagagtggtacaacaaccgcaatcaggacaactatgtttcttggagtgattctgaagaggaagatgaggatgaagaggtggagaccaaagacaggggtgaagccaactttccttcgccattcaccaacattctttgtggaattatctttgtggagaggcgttacactgcagtagtcctaaatcggtag

//