LOCUS       XM_051103271            1481 bp    mRNA    linear   VRT 26-FEB-2023
DEFINITION  PREDICTED: Labeo rohita uncharacterized LOC127160616
            (LOC127160616), mRNA.
ACCESSION   XM_051103271
VERSION     XM_051103271.1
DBLINK      BioProject: PRJNA887821
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Labeo rohita (rohu)
  ORGANISM  Labeo rohita
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Cyprinidae; Labeoninae; Labeonini; Labeo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_026129321) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_022985175.1-RS_2023_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/26/2023
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 28% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1481
                     /organism="Labeo rohita"
                     /mol_type="mRNA"
                     /strain="BAU-BD-2019"
                     /isolation_source="riverine"
                     /db_xref="taxon:84645"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
                     /dev_stage="adult"
     gene            1..1481
                     /gene="LOC127160616"
                     /note="uncharacterized LOC127160616; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon."
                     /db_xref="GeneID:127160616"
     CDS             1..1440
                     /gene="LOC127160616"
                     /codon_start=1
                     /product="uncharacterized protein LOC127160616"
                     /protein_id="XP_050959228.1"
                     /db_xref="GeneID:127160616"
                     /translation="

MGHLYELLVYTVQRDCGVQLFCSEHLDMMKSFQLYHLQLLYLLIAALLECEVVTQRRCKQVHHLNINCVQGDNMSISCLTTTHPLQSLTVKLHRTNQDKNILMYPDISPEPEHQRWSVRKDAGNVTLDLKDIRLSDHGLYDCQVYKNQDCLNVIRFNLKVKECKTLDSVHPTPGSSVLLPCSEHPLQNRTEQVNWTVVIGHQSTDITQYRPPNKPSSSTENLLKPLYERVRQLKNGSLLITDVVHTDELWYQCRVNEKTCYEVKLLLKECKTLDSVHPTPGSSVLLPCSEHPLQHRTEQVNWTVVIGHQSTDITQYRPPNKPSSSTENLLKPLYERVRQLKNGSLLITDVVHTDELWYQCRVNEKTCYEVKLLLLKVITDAPTPADSTVFQTEDYSTDESETVTTETVTVNLTVVVMITIVSLCVLISLTVLYFKQPRPEFDNQIESNCQTIVYYSKVSGGLDVPLYSLVQRNTNHDHL"

     misc_feature    193..426
                     /gene="LOC127160616"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:448366"
     misc_feature    220..234
                     /gene="LOC127160616"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    259..273
                     /gene="LOC127160616"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    373..387
                     /gene="LOC127160616"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    <682..>759
                     /gene="LOC127160616"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:448366"
     misc_feature    706..720
                     /gene="LOC127160616"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    <1003..>1080
                     /gene="LOC127160616"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:448366"
     misc_feature    1027..1041
                     /gene="LOC127160616"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
ORIGIN      

atggggcacctatatgagctgctggtttacacagtgcagagagattgtggagttcaactgttctgcagtgagcatctggatatgatgaagagttttcagctttaccatttacaactcctgtatcttctaatagcagctttattagaatgcgaagtggtgacacagagacgctgcaaacaggttcatcacttgaacataaactgtgttcagggtgacaacatgtctatttcttgcctaaccacaacccacccgctgcagtctctaacagtgaaactgcacaggaccaaccaagataaaaacatcctgatgtatccagacatctctccagaaccagagcaccagagatggtctgtgaggaaagatgctggaaatgttacacttgatctgaaagacatcagattatccgatcatggcctttatgactgtcaggtctacaagaatcaggactgccttaatgtcattcgatttaacctaaaagtcaaagaatgtaaaactttggactctgttcatccaacaccaggctcttcagtgttgctgccatgctctgaacatcctctacaaaacagaactgaacaagtcaattggacagttgttattggtcaccagtcaacagatataactcagtatcgcccaccaaacaagccctcaagcagcacagagaatctcctgaagcctctgtatgaaagagtgagacaactaaaaaacggatctctgcttataacagatgtagttcacactgatgaattgtggtatcagtgcagagtgaatgaaaaaacctgctatgaagtgaagctgctcctgaaagagtgtaaaactttagactctgtccatccaacaccaggctcttcagtgttgctgccatgctctgaacatcctctacaacacagaactgaacaagtcaattggacagttgttattggtcaccagtcaacagatataactcagtatcgcccaccaaacaagccctcaagcagcacagagaatctcctgaagcctctgtatgaaagagtgagacaactaaaaaacggatctctgcttataacagatgtagttcacactgatgaattgtggtatcagtgcagagtgaatgaaaaaacctgctatgaagtgaagctgctgctgctgaaagtgatcacagatgctccaaccccagctgacagtacggtttttcagactgaagactacagtactgatgagagtgaaacagtgacaactgaaacagtgacagttaatctgacagtggtggtgatgatcacaatagtgtctctgtgtgtcctcatatcactgaccgttctttatttcaaacaaccaagaccagaatttgacaaccaaattgaatcaaactgccagactatcgtatattattctaaagtttcaggagggttggatgtcccgttgtattctttagttcaacgtaacacaaaccatgaccacctctagtgtgaagaaactgaagcttctgcatgtaatccagaccacat

//