2024-05-20 10:06:25, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_050629069 3746 bp mRNA linear INV 16-SEP-2022 DEFINITION PREDICTED: Bombus huntii copper-transporting ATPase 1 (LOC126870896), transcript variant X16, mRNA. ACCESSION XM_050629069 VERSION XM_050629069.1 DBLINK BioProject: PRJNA880168 KEYWORDS RefSeq. SOURCE Bombus huntii ORGANISM Bombus huntii Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Aculeata; Apoidea; Anthophila; Apidae; Bombus; Pyrobombus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_066248) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: Bombus huntii Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3746 /organism="Bombus huntii" /mol_type="mRNA" /isolate="Logan2020A" /isolation_source="nest" /db_xref="taxon:85661" /chromosome="11" /sex="male" /tissue_type="slice of abdomen" /dev_stage="adult" /country="USA: Utah, Cache County, Logan" /collection_date="2020-07-04" /collected_by="Jonathan Koch" /identified_by="Jonathan Koch" gene 1..3746 /gene="LOC126870896" /note="copper-transporting ATPase 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 5 Proteins" /db_xref="GeneID:126870896" CDS 419..3610 /gene="LOC126870896" /codon_start=1 /product="copper-transporting ATPase 1 isoform X6" /protein_id="XP_050485026.1" /db_xref="GeneID:126870896" /translation="
MESEINTKTLIDDNHQLNKISTEQADRENAANAELTVTKKDDGEGDTDYEGTVQMVYVPRSQKMKDSTNISTMKVNIDGMRCQSCVKNIERTIGSRPEVLSVKVILEEKLGYIEFKAEEITPNELVEAIEDMGFTASLCSDESSSTEKIQRSDSLQLTISTCTVHIDGMTCASCVKTIIDSLSQKAGIKQANVSLEKKEATVSYNDKDLTAEQISGFVEEMGFNSFVKEVNGKVLGDETPMNLSLKNNSAQEELPLQMNGGGDVKTRNETAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVAFDPNKIRAIDIASSISELGFPTTLIEEPGTGEGDIELKITGMTCASCVNKIESTVRKLPGVRSAAVALATQRGKFKYDVEKIGVRDIIECINKLGFTAMLFSNKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSIGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLAAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLISIDLVQRGDVLKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPLVIVVSIVTLFVWIIVGYVNVNSLPISHNDQIKKHGLNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSETTGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYINEVKRLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTNPDDVYEICVGNREWMRRNAINIPQEVELKMVIEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQSICRSVTFAQSC"
misc_feature 638..829 /gene="LOC126870896" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(656..664,671..673) /gene="LOC126870896" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 914..1087 /gene="LOC126870896" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(923..931,938..940) /gene="LOC126870896" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1241..1435 /gene="LOC126870896" /note="copper chaperone CopZ; Region: chaper_CopZ_Eh; NF033794" /db_xref="CDD:411374" misc_feature 1466..1654 /gene="LOC126870896" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1484..1492,1499..1501) /gene="LOC126870896" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1733..>3571 /gene="LOC126870896" /note="Haloacid Dehalogenase-like Hydrolases; Region: HAD_like; cl21460" /db_xref="CDD:451251" ORIGIN
gtgaatagaaacctattgtctatctattgcctgtgctgatatttacatagtttattactaatcgaatccattaatttcggtttaactatgaattttttataggttagattacatttattaagcaattctgatagtatccagttagaacagtgtatagaacaagaatccgtttaacctaataagttttgtaaacttattttagatcgcatgtttatatatatatttttgtttttttttattactttatcaaaagtaaagtgtatgttcacaattgtaatcggtaaataagattttgccagtaatgtattcctctctgatggtgcattatgtgtgtaagataatgaaaaaagtgaatcataaattaaactgttcactttgatgaaaacattttattttcaaatttgatattattgaagaaatggaatcagaaattaatacaaagacattaatagatgacaatcatcagcttaataaaatcagtacagaacaggctgacagggaaaatgcggcaaatgcagagctgacagtaacaaaaaaagacgatggggagggcgataccgattacgaaggcacggtacagatggtgtacgttcctcggtcgcagaaaatgaaagattccacgaatatttctactatgaaggttaatatcgacggtatgagatgccagagctgtgtgaagaacatcgagagaaccataggtagccgaccggaggttttaagcgttaaagtaatcctagaagagaagctcggctacatcgaatttaaagcggaagaaattacgccgaacgaattggtcgaagcgatagaggatatgggtttcaccgcttccctatgcagcgacgaaagtagctctaccgaaaagatacaaagaagtgattcgttacaattaactatcagtacttgtaccgtacatatcgatggaatgacttgcgcgtcttgtgttaaaactatcattgacagtttatcgcagaaagcaggaataaaacaggcgaacgttagtttagagaagaaggaagctacggtttcttacaacgacaaggacctaacggctgaacaaatatcagggttcgtcgaggaaatgggttttaattcgtttgttaaagaagtaaacggtaaagttctaggagatgaaacaccaatgaatttatcgttaaaaaacaattctgcgcaagaggaacttccgttgcaaatgaatgggggaggtgatgtaaagactcgaaacgaaacagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgtcgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtagcattgatggcggccaaggcagaagttgcctttgatccgaataagataagggcgattgacatcgcttctagcatatcggaattgggcttccctactactttgatcgaggaacctggcactggagagggagatatcgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaggaaattaccgggcgtccgttctgccgctgttgcgttggcaactcaacgtggcaaattcaaatacgatgtagaaaaaattggcgtcagggacattatcgaatgcattaacaaattaggtttcaccgcaatgttatttagtaataaagataaagagaacagagactacttggatcagagggaagaaataaacaagtggcggacagcgtttttagtgtccttaatttttggcataccgtgtatgttagccatgacatacttcatggtaatcatgtctattggtgaaaaaacgcacgaagatatgtgttgcgtagttcctggtctttcctgggaaaatttaatccttttcatattttctacaccagtccagttttttggcggctggcatttttacgttcaagcgtacaaagctttgaaacacggtacgactaatatggatgttttaatttctatgactactacgatatcttatttgtactcagtcgccgtacttgcagcagctatgataatgcaggaacacgttagtcctcagacattttttgatactcctcccatgttgttagtgttcatcagtttaggaagatggttagaacatgtcgcaaagggtaaaacatcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaacaatgaactactatctgagcgtttgatcagtatagatttagtacaacggggcgatgtcctaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagcctaattaccggggaaagtatgccggtaccgaaaaagaagggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaattactgccacgcatacaggagaacacacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctatccaacatttagccgataagatagctggttatttcatacctcttgttatagttgtttctatagtaactttattcgtttggataatagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgatcaaatcaaaaaacacggattgaatagagaagaaattatatttcaatatgcttttcgaagcgcgctttgcgtattagcgatagcttgtccatgcgcgttaggattggctacgccaactgctgttatggttggtactggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttagaaaatgcgcacaaagttaaatgtattgtatttgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagttcttagtcattatctgtacagctgaaacaaacagcgaacatccgatcgcatcagcaattgtgcggtacgtgaaggaaacaataggctctgaaacaactggacagtgcatgaattttcaagcagttgctggttgtggacttaaatgtaaagtatcacatatttcaactacgttggccgatgcattaaaatctgataagattcttaactatattaacgaagtaaaaagattaccttctggaacgcataacttaaataatgtgtcgatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactaatcctgacgatgtatatgaaatttgcgttggtaacagagagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttattgaagaagatctaggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagcgtagcagatacggttaaaccagaagcccatctggcaatctatactttgaaaaagatgggtttagaagtcattcttttaacaggagataatagaaagactgctgtttctatcgctagacaaagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcagcgtttacaagatcaaggcttaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagatgttggcattgcaatatcttctggtacggatgttgctgtggaagctgccgat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]