2024-05-06 18:01:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_050578193 930 bp mRNA linear INV 09-SEP-2022 DEFINITION PREDICTED: Adelges cooleyi germ cell nuclear acidic protein-like (LOC126841610), mRNA. ACCESSION XM_050578193 VERSION XM_050578193.1 DBLINK BioProject: PRJNA877624 KEYWORDS RefSeq; includes ab initio. SOURCE Adelges cooleyi (spruce gall adelgid) ORGANISM Adelges cooleyi Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Paraneoptera; Hemiptera; Sternorrhyncha; Aphidomorpha; Phylloxeroidea; Adelgidae; Adelges; Gilletteella. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_026096076) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: Adelges cooleyi Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 100% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..930 /organism="Adelges cooleyi" /mol_type="mRNA" /isolate="19-005CV" /isolation_source="galling 4th instar nymphs" /host="Picea sp." /db_xref="taxon:133065" /chromosome="Unknown" /tissue_type="whole body" /country="USA: Idaho, Franklin county, ID-36 through Emigration Canyon" /collection_date="2019-07-23" /identified_by="Carol von Dohlen" gene 1..930 /gene="LOC126841610" /note="germ cell nuclear acidic protein-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 12 Proteins" /db_xref="GeneID:126841610" CDS 1..930 /gene="LOC126841610" /codon_start=1 /product="germ cell nuclear acidic protein-like" /protein_id="XP_050434150.1" /db_xref="GeneID:126841610" /translation="
MAPLERDPPKFLFDHITDINEDFLTDDEEELFPERLIYNDIDTRDRDTDEEIDINTDELNNYIPEIVLEVIRQWSTYFNSAVPPLVNNHDTETEDSDDESIETDETDDRETEDNDDMSIETDEADDRETEDNDDTETEDSDDKETEDNDDTETEDNDDKSIETDETDDRETEDNDDKSIETDETDDRETEDNDDTETEDSDDKETEDNDDTETENNDDKSIETDETDDRETEDNDDESIETDETDKIPTTTTNIPGTSCPHTASMQGLHISSLKRPRLDSDDEQPRSTKRRRPTSYQSESEESESDNFQ"
misc_feature <253..735 /gene="LOC126841610" /note="Midasin, AAA ATPase with vWA domain, involved in ribosome maturation [Translation, ribosomal structure and biogenesis]; Region: MDN1; COG5271" /db_xref="CDD:227596" ORIGIN
atggcaccgttagaaagagatccacccaaattcttatttgatcatataacagacataaacgaagacttcttgacggacgacgaagaagagttatttccagaacgccttatatacaacgacatagacacaagagatagagacacggacgaagagattgacataaacaccgacgagttaaataactatatacctgaaatagtattggaagtcattagacaatggagtacatactttaatagtgctgttccgccacttgtcaacaaccatgacacagagacagaggacagcgatgacgagtcaattgagacagacgaaaccgacgacagagagacagaagacaacgatgacatgtcaattgagacagacgaagccgacgatagagagacagaggacaacgatgacacagagacagaagacagcgatgacaaagagacagaggacaacgatgacacagagacagaggacaacgatgacaagtcaattgagacagacgaaaccgacgacagagagacagaagacaacgatgacaagtcaattgagacagatgaaaccgacgacagagagacagaggacaacgatgacacagagacagaagacagcgatgacaaagagacagaggacaacgatgacacagagacagagaacaacgatgacaagtcaattgagacagacgaaaccgacgacagagagacagaagacaacgatgacgagtcaattgagacagacgaaaccgacaaaatcccgacgacgacgacgaatattcccggaacttcatgcccacatacagcttcgatgcaaggcttgcatatttcaagtctgaagagaccgcgtttagactctgatgatgagcaacccaggtcaacaaagcggagacggccaacgtcgtaccagtcagaaagcgaagaaagcgagtcggacaactttcaatag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]