2024-05-20 10:06:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_050086924 2310 bp mRNA linear INV 15-AUG-2022 DEFINITION PREDICTED: Schistocerca serialis cubense basic proline-rich protein-like (LOC126419747), mRNA. ACCESSION XM_050086924 VERSION XM_050086924.1 DBLINK BioProject: PRJNA857088 KEYWORDS RefSeq; includes ab initio. SOURCE Schistocerca serialis cubense ORGANISM Schistocerca serialis cubense Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Polyneoptera; Orthoptera; Caelifera; Acrididea; Acridomorpha; Acridoidea; Acrididae; Cyrtacanthacridinae; Schistocerca. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_064646) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: Schistocerca serialis cubense Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 100% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..2310 /organism="Schistocerca serialis cubense" /mol_type="mRNA" /isolate="TAMUIC-IGC-003099" /isolation_source="physical" /sub_species="cubense" /specimen_voucher="TAMUIC-IGC-003099" /db_xref="taxon:2023355" /chromosome="9" /sex="female" /tissue_type="Whole body" /dev_stage="adult" /country="USA: Florida, Islamorada" /collection_date="2021-03-08" /collected_by="Hojun Song" /identified_by="Hojun Song" gene 1..2310 /gene="LOC126419747" /note="basic proline-rich protein-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 Protein" /db_xref="GeneID:126419747" CDS 1..2310 /gene="LOC126419747" /codon_start=1 /product="basic proline-rich protein-like" /protein_id="XP_049942881.1" /db_xref="GeneID:126419747" /translation="
MALPLPLPRWLCPCPCLDGSAPAPAPASMALPLPLPLPRCPCPCPCPCLDAPAPAPAPASMPLPLPLPLPRCPCPCPCPCLDAPAPAPAPASMPLPLPLPLPRCPCPCPCLDAPAPAPAPASMALPLPLPRWPCPCPCLDGPAPAPASMALPLPLPRWPCPCPCLDGPAPAPASMALPLPLPRWPCPCPCLDGPAPAPASMALPLPLPRWPCPCPCLDGPAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCPCPDGSAPAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPLPRWLCPCPCLDGSAPAPAPASMALPLPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWLCPCPCLDGSAPAPASMALPLPLPRWL"
misc_feature <370..912 /gene="LOC126419747" /note="large tegument protein UL36; Provisional; Region: PHA03247" /db_xref="CDD:223021" ORIGIN
atggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcctcgatgcccctgcccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggccctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgccccgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcccctgcccctgcctcgatggctctgcctctgcccctgcctcgatggctctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]