2024-05-19 12:58:56, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_049328933 591 bp mRNA linear PLN 15-JUL-2022 DEFINITION Alternaria metachromatica uncharacterized protein (J4E83_001981), partial mRNA. ACCESSION XM_049328933 VERSION XM_049328933.1 DBLINK BioProject: PRJNA858129 BioSample: SAMN18144510 KEYWORDS RefSeq. SOURCE Alternaria metachromatica ORGANISM Alternaria metachromatica Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae; Pleosporaceae; Alternaria; Alternaria sect. Infectoriae. REFERENCE 1 (bases 1 to 591) AUTHORS Fulcher,M. TITLE Comparative genomics of the Alternaria infectoria species group JOURNAL Unpublished REFERENCE 2 (bases 1 to 591) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (15-JUL-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 591) AUTHORS Fulcher,M. TITLE Direct Submission JOURNAL Submitted (26-MAR-2021) Plant Pathology and Plant Microbe Biology, Cornell University, 334 Plant Science Building, Ithaca, NY 14851, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_026055494). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..591 /organism="Alternaria metachromatica" /mol_type="mRNA" /strain="BMP 0045" /host="Triticum aestivum" /type_material="culture from type material of Alternaria metachromatica" /db_xref="taxon:283354" /chromosome="Unknown" /country="Australia" /collection_date="1985" gene <1..>591 /locus_tag="J4E83_001981" /db_xref="GeneID:73390362" CDS 1..591 /locus_tag="J4E83_001981" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_049191905.1" /db_xref="GeneID:73390362" /db_xref="InterPro:IPR001424" /db_xref="InterPro:IPR006121" /db_xref="InterPro:IPR024134" /db_xref="InterPro:IPR036163" /db_xref="InterPro:IPR036423" /db_xref="PFAM:PF00080" /db_xref="PFAM:PF00403" /translation="
MTVPSFETIFAVPMTCQSCINDIEGSLQQLGGVNKITANLKDQLVSVEGTAAPSAIVEAIQATGRDAILRGSGRSDKSHAPNVENKVRGLVRMVEVAPSMTIIDLSIRGLSPGTYQATVRESGDISDGPESTGAIWEYLKAKKEDKPCRGIFGTVQVGKGGVGSVFLDKPIHIWEMIGRSIVVAREQDGKVCETAS"
misc_feature 1..567 /locus_tag="J4E83_001981" /note="copper, zinc superoxide dismutase; Region: PLN02957" /db_xref="CDD:215516" ORIGIN
atgactgtcccgtcgtttgaaaccatcttcgcggtgcctatgacctgccagtcgtgcatcaacgacatcgaaggctccctccagcaattgggtggtgtcaacaaaatcactgccaaccttaaagatcaactggtatctgtcgagggcacagcagcgccatcggccattgttgaagctattcaagcaactggccgcgatgcaattctaagaggatctggaagatcagacaaatcgcacgcacctaatgtagagaacaaagttcgaggattagtgcgcatggttgaagtagctccgagtatgactatcatcgatctgagcataaggggattgtcgcctggaacgtaccaggccacagttcgcgaatctggcgacatatccgacggaccagaatctaccggcgccatctgggagtatctcaaggccaaaaaggaagacaagccgtgtcggggcatctttggaaccgtccaggtaggaaagggtggagtcggatctgtgttcctggacaagcccatccacatctgggagatgatcggacgtagcatcgtggttgcgcgagagcaagacggcaaggtatgcgaaaccgctagttga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]