2024-05-16 11:58:32, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_047566734 3368 bp mRNA linear ROD 04-MAR-2023 DEFINITION PREDICTED: Sciurus carolinensis nuclear factor kappa B subunit 1 (Nfkb1), transcript variant X5, mRNA. ACCESSION XM_047566734 VERSION XM_047566734.1 DBLINK BioProject: PRJNA823697 KEYWORDS RefSeq. SOURCE Sciurus carolinensis (gray squirrel) ORGANISM Sciurus carolinensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Sciuromorpha; Sciuridae; Sciurinae; Sciurini; Sciurus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_062222) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_902686445.1-RS_2023_03 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 03/03/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3368 /organism="Sciurus carolinensis" /mol_type="mRNA" /db_xref="taxon:30640" /chromosome="10" gene 1..3368 /gene="Nfkb1" /note="nuclear factor kappa B subunit 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:124994613" CDS 16..2694 /gene="Nfkb1" /codon_start=1 /product="nuclear factor NF-kappa-B p105 subunit isoform X4" /protein_id="XP_047422690.1" /db_xref="GeneID:124994613" /translation="
MTAICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVNAGPKDMVVGFANLGILHVTKKKVFETLEARMTDACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGSTGTTGPGYGFPHYGFPTYGGITFHPGTTKSNAGLKHGTMNAESKSDPEDCDTRGGRETINLSGNVIKTTEQDKELGMSSDGNEEVTPTCTMGVKEEDARFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLVSDDIINMRNDLYQTPLHLAVITKQEDVVEDLLSAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGEGLNAIHIAVMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTKLAALLKAAGADPLVENFEPLYDLDDSWEKAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSEDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVKELVEALRQMGYTEAIEVIQAAFCTSEASSPVKTTSQAHSLPLLPSSTRQQIDELRDNDSICDSGVETSFRKLSFTESLTNSSSLLTLNKMPQDYGQEGPIEGKI"
misc_feature <25..498 /gene="Nfkb1" /note="N-terminal sub-domain of the Rel homology domain (RHD); Region: RHD-n; cl08275" /db_xref="CDD:447596" misc_feature 517..822 /gene="Nfkb1" /note="IPT domain of the transcription factor NFkappaB and related transcription factors. NFkappaB is considered a central regulator of stress responses, activated by different stressful conditions, including physical stress, oxidative stress, and exposure to...; Region: IPT_NFkappaB; cd01177" /db_xref="CDD:238582" misc_feature order(520..522,526..534,538..546,664..672,709..711, 745..747,802..804,811..813,817..819) /gene="Nfkb1" /note="ankyrin protein binding site [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(526..531,535..537,574..576,580..582,586..588, 685..690,697..699,703..705) /gene="Nfkb1" /note="dimerization interface [polypeptide binding]; other site" /db_xref="CDD:238582" misc_feature order(589..591,595..597,688..693) /gene="Nfkb1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238582" misc_feature <1381..1605 /gene="Nfkb1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature order(1393..1395,1399..1401,1411..1416,1423..1431, 1435..1440,1450..1452,1459..1461,1504..1506,1510..1512, 1516..1518,1528..1533,1540..1548,1552..1557,1567..1569, 1576..1578,1603..1605,1609..1611,1615..1617,1627..1632, 1639..1647,1651..1656,1666..1668,1675..1677) /gene="Nfkb1" /note="oligomer interface [polypeptide binding]; other site" /db_xref="CDD:293786" misc_feature 1393..1506 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1510..1605 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1525..1809 /gene="Nfkb1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 1717..1809 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 1732..>1962 /gene="Nfkb1" /note="Ankyrin repeats (3 copies); Region: Ank_2; pfam12796" /db_xref="CDD:432791" misc_feature 1819..1917 /gene="Nfkb1" /note="ANK repeat [structural motif]; Region: ANK repeat" /db_xref="CDD:293786" misc_feature 2215..2439 /gene="Nfkb1" /note="Death domain of the Nuclear Factor-KappaB1 precursor protein p105; Region: Death_NFkB1_p105; cd08797" /db_xref="CDD:260063" ORIGIN
tgagaaccctcaacaatgacagctatatgcaactatgtgggacctgcaaaggttattgttcagttggtcacaaacggaaaaaatatccacctgcacgctcacagcctggtgggaaaacactgtgaggatggaatctgcactgtgaatgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacggatgaccgacgcatgtgtaaggggctacaatccaggacttttagtgcaccctgaccttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagctcatccgccaggcagctcttcagcagacgaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttcctgacagcacgggcagcttcaccaggcgcctggaacccgtggtgtcagacgccatctatgacagcaaagcacccaatgcatccaacttgaaaatcgtaagaatggacaggacagctggatgtgtaactggaggggaagaaatttatcttctctgtgacaaagttcagaaagatgatatccagattcgtttttatgaagaggaggaaaatggtggagtctgggaaggatttggagatttttcccctacagatgttcatagacaatttgccattgtcttcaaaacgccaaagtataaagatgtcaacattacaaaaccagcctctgtgtttgtccagcttcggaggaaatctgatttggaaactagcgaaccaaaaccttttctctactatcctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaatttttcggatagtttcggcggcggtagcggtgccggggctggaggcggaggcatgttcggtagcggcggtggaggagggagcacgggaactacgggtccagggtatggcttcccgcactatggatttcctacgtacggtggaattaccttccaccctggaaccactaaatccaatgctggactgaagcatggaaccatgaatgctgaatctaaaagtgatcctgaagattgtgacacgaggggtggcagagagactataaatctctctgggaacgttatcaaaaccacagaacaagataaggaactgggcatgtccagcgacggaaatgaggaggtgacgccgacgtgcaccatgggagtaaaggaagaggatgctcggtttcaggataacctctttctggagaaggctatgcagcttgccaagaggcacgccaacgcccttttcgactatgcagtgacgggagacgtgaagatgctgctggctgtccagcggcatctcactgcagtgcaggatgagaatggggacagtgtcttacacttagccatcatccaccttcatgctcagcttgtgagggatctgctagaagttacatctggtttggtttctgatgatattatcaacatgagaaatgatctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggacttgctgagcgctggggctgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtattttactcaagcacaaaaaggcagcactacttcttgaccatcccaacggggaaggtctgaatgccattcacatagccgtgatgagcaatagcctgccatgtctgctgctgctggtggccgctggagcagacgtcaacgcacaggagcagaagtctgggcgaacggcactgcacctggctgtggagcatgacaatatctccttggcgggctgcctgctcctggagggggatgcccacgtggacagtaccacctatgatggaactacacccctacacatcgcagccggcagagggtccaccaagctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaaggctggagaggacgaaggggtcgtgcctggaaccacacccctagatatggctaccagctggcaggtatttgacatcttaaatgggaagccatatgagccagagtttacatctgaggatttgctggcacagggagacatgaaacagctgactgaagatgcaaaactgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaagttaggtctggggatacttaacaatgccttccggctgagccctgccccttccaaaactctcatggacaactatgaggtctctggggggacggtcaaagagctggtggaggccctgagacagatgggctacacggaagcaatcgaagttatccaggcggccttctgcacctcagaagcctccagccctgtgaagaccacctctcaggcccactcactgcctctcttgccttcctccacaaggcagcaaatagatgagctgcgagacaatgacagcatctgtgacagtggtgtggagacatccttccgcaaactcagctttacagagtctctgaccaacagcagctcattgctaactcttaacaaaatgccccaagattacgggcaggaaggacctatagaaggcaaaatttagcctgctggcagtttcccacgctgtgtaaaccaaagtcctagaatcccactgcgttgtccaaaagaaggaaagtaaagtgcatccagaggtgctcagaggaacagcggcctgcctgaatcatgctggatttaattcaaggctgtctaaacatgacttcctttcctggtttttcaatgagttttagttgattcacttgccaatagtatctagcaatcccagcactgcgctgaactgatgtgtcctggggatgaggtagtttattgagctttaccggctgctactggattacagttgctttttgttgtcattgctgctgtccctctgctgcattcccactgtcagggtgtcctcacctggtgttctttctagccgtccatggcacagttgtgcattcagattaaggattaagaaaagagatatttgaatatcagagtcacttagtgtgcaattaaaaaaaaaaggcttattgctttttttaatgtggttatctctgtgatttgaaaaacacatgaacttatcaatatttaaacatggttataatcagtgctgaaaatgatattttcccctttttctgcattttgctattgtaaatatgttttttagatcaaatactttaaaggaaaaatgttggatttataaatgctattttttattttacttttataataaaagga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]