GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-16 12:08:51, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_047566731            3625 bp    mRNA    linear   ROD 04-MAR-2023
DEFINITION  PREDICTED: Sciurus carolinensis nuclear factor kappa B subunit 1
            (Nfkb1), transcript variant X2, mRNA.
ACCESSION   XM_047566731
VERSION     XM_047566731.1
DBLINK      BioProject: PRJNA823697
KEYWORDS    RefSeq.
SOURCE      Sciurus carolinensis (gray squirrel)
  ORGANISM  Sciurus carolinensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciuromorpha; Sciuridae; Sciurinae; Sciurini; Sciurus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_062222) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_902686445.1-RS_2023_03
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 03/03/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3625
                     /organism="Sciurus carolinensis"
                     /mol_type="mRNA"
                     /db_xref="taxon:30640"
                     /chromosome="10"
     gene            1..3625
                     /gene="Nfkb1"
                     /note="nuclear factor kappa B subunit 1; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 12 Proteins, and 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:124994613"
     CDS             26..2950
                     /gene="Nfkb1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X1"
                     /protein_id="XP_047422687.1"
                     /db_xref="GeneID:124994613"
                     /translation="
MAGNNPYGGVPEQIFHLNPLSHTIFNPELFPPEMPLPTADGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVNAGPKDMVVGFANLGILHVTKKKVFETLEARMTDACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGSTGTTGPGYGFPHYGFPTYGGITFHPGTTKSNAGLKHGTMNAESKSDPEDCDTRGGRETINLSGNVIKTTEQDKELGMSSDGNEEVTPTCTMGVKEEDARFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLVSDDIINMRNDLYQTPLHLAVITKQEDVVEDLLSAGADLSLLDRLGNSVLHLAAKEGHDKVLSILLKHKKAALLLDHPNGEGLNAIHIAVMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTKLAALLKAAGADPLVENFEPLYDLDDSWEKAGEDEGVVPGTTPLDMATSWQVFDILNGKPYEPEFTSEDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTVKELVEALRQMGYTEAIEVIQAAFCTSEASSPVKTTSQAHSLPLLPSSTRQQIDELRDNDSICDSGVETSFRKLSFTESLTNSSSLLTLNKMPQDYGQEGPIEGKI"
     misc_feature    149..754
                     /gene="Nfkb1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(191..193,197..202,206..211,218..229,452..454,
                     458..463,752..754)
                     /gene="Nfkb1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    773..1078
                     /gene="Nfkb1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(776..778,782..790,794..802,920..928,965..967,
                     1001..1003,1058..1060,1067..1069,1073..1075)
                     /gene="Nfkb1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(782..787,791..793,830..832,836..838,842..844,
                     941..946,953..955,959..961)
                     /gene="Nfkb1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(845..847,851..853,944..949)
                     /gene="Nfkb1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    <1637..1861
                     /gene="Nfkb1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    order(1649..1651,1655..1657,1667..1672,1679..1687,
                     1691..1696,1706..1708,1715..1717,1760..1762,1766..1768,
                     1772..1774,1784..1789,1796..1804,1808..1813,1823..1825,
                     1832..1834,1859..1861,1865..1867,1871..1873,1883..1888,
                     1895..1903,1907..1912,1922..1924,1931..1933)
                     /gene="Nfkb1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1649..1762
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1766..1861
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1781..2065
                     /gene="Nfkb1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    1973..2065
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1988..>2218
                     /gene="Nfkb1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    2075..2173
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2471..2695
                     /gene="Nfkb1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
aagctttcctaaaagcagctccagaatggcaggaaacaatccatatgggggagtgcctgaacaaatatttcatttgaatcctttgtctcatactatatttaatccagaattatttccaccagagatgccactgcccacagcagatggcccataccttcaaatattagagcaacctaaacagagaggatttcgtttccgttacgtttgtgaagggccatcccatggcggacttcctggtgcatctagtgagaagaacaagaagtcctaccctcaggtcaaaatatgcaactatgtgggacctgcaaaggttattgttcagttggtcacaaacggaaaaaatatccacctgcacgctcacagcctggtgggaaaacactgtgaggatggaatctgcactgtgaatgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacggatgaccgacgcatgtgtaaggggctacaatccaggacttttagtgcaccctgaccttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagctcatccgccaggcagctcttcagcagacgaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttcctgacagcacgggcagcttcaccaggcgcctggaacccgtggtgtcagacgccatctatgacagcaaagcacccaatgcatccaacttgaaaatcgtaagaatggacaggacagctggatgtgtaactggaggggaagaaatttatcttctctgtgacaaagttcagaaagatgatatccagattcgtttttatgaagaggaggaaaatggtggagtctgggaaggatttggagatttttcccctacagatgttcatagacaatttgccattgtcttcaaaacgccaaagtataaagatgtcaacattacaaaaccagcctctgtgtttgtccagcttcggaggaaatctgatttggaaactagcgaaccaaaaccttttctctactatcctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaatttttcggatagtttcggcggcggtagcggtgccggggctggaggcggaggcatgttcggtagcggcggtggaggagggagcacgggaactacgggtccagggtatggcttcccgcactatggatttcctacgtacggtggaattaccttccaccctggaaccactaaatccaatgctggactgaagcatggaaccatgaatgctgaatctaaaagtgatcctgaagattgtgacacgaggggtggcagagagactataaatctctctgggaacgttatcaaaaccacagaacaagataaggaactgggcatgtccagcgacggaaatgaggaggtgacgccgacgtgcaccatgggagtaaaggaagaggatgctcggtttcaggataacctctttctggagaaggctatgcagcttgccaagaggcacgccaacgcccttttcgactatgcagtgacgggagacgtgaagatgctgctggctgtccagcggcatctcactgcagtgcaggatgagaatggggacagtgtcttacacttagccatcatccaccttcatgctcagcttgtgagggatctgctagaagttacatctggtttggtttctgatgatattatcaacatgagaaatgatctgtaccagacgcccttgcacttggcagtgatcactaagcaggaagatgtggtggaggacttgctgagcgctggggctgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtattttactcaagcacaaaaaggcagcactacttcttgaccatcccaacggggaaggtctgaatgccattcacatagccgtgatgagcaatagcctgccatgtctgctgctgctggtggccgctggagcagacgtcaacgcacaggagcagaagtctgggcgaacggcactgcacctggctgtggagcatgacaatatctccttggcgggctgcctgctcctggagggggatgcccacgtggacagtaccacctatgatggaactacacccctacacatcgcagccggcagagggtccaccaagctggcagctcttctcaaagcagcaggagcagatcccctggtggagaactttgagcctctctatgacctggatgactcttgggaaaaggctggagaggacgaaggggtcgtgcctggaaccacacccctagatatggctaccagctggcaggtatttgacatcttaaatgggaagccatatgagccagagtttacatctgaggatttgctggcacagggagacatgaaacagctgactgaagatgcaaaactgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaagttaggtctggggatacttaacaatgccttccggctgagccctgccccttccaaaactctcatggacaactatgaggtctctggggggacggtcaaagagctggtggaggccctgagacagatgggctacacggaagcaatcgaagttatccaggcggccttctgcacctcagaagcctccagccctgtgaagaccacctctcaggcccactcactgcctctcttgccttcctccacaaggcagcaaatagatgagctgcgagacaatgacagcatctgtgacagtggtgtggagacatccttccgcaaactcagctttacagagtctctgaccaacagcagctcattgctaactcttaacaaaatgccccaagattacgggcaggaaggacctatagaaggcaaaatttagcctgctggcagtttcccacgctgtgtaaaccaaagtcctagaatcccactgcgttgtccaaaagaaggaaagtaaagtgcatccagaggtgctcagaggaacagcggcctgcctgaatcatgctggatttaattcaaggctgtctaaacatgacttcctttcctggtttttcaatgagttttagttgattcacttgccaatagtatctagcaatcccagcactgcgctgaactgatgtgtcctggggatgaggtagtttattgagctttaccggctgctactggattacagttgctttttgttgtcattgctgctgtccctctgctgcattcccactgtcagggtgtcctcacctggtgttctttctagccgtccatggcacagttgtgcattcagattaaggattaagaaaagagatatttgaatatcagagtcacttagtgtgcaattaaaaaaaaaaggcttattgctttttttaatgtggttatctctgtgatttgaaaaacacatgaacttatcaatatttaaacatggttataatcagtgctgaaaatgatattttcccctttttctgcattttgctattgtaaatatgttttttagatcaaatactttaaaggaaaaatgttggatttataaatgctattttttattttacttttataataaaaggaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]