GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 12:16:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_046230320            3039 bp    mRNA    linear   PLN 14-MAR-2022
DEFINITION  Lentinula edodes NRDE-2, necessary for RNA
            interference-domain-containing protein (C8R40DRAFT_1162984),
            partial mRNA.
ACCESSION   XM_046230320
VERSION     XM_046230320.1
DBLINK      BioProject: PRJNA801212
            BioSample: SAMN08778769
KEYWORDS    RefSeq.
SOURCE      Lentinula edodes (shiitake mushroom)
  ORGANISM  Lentinula edodes
            Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
            Agaricomycetes; Agaricomycetidae; Agaricales; Marasmiineae;
            Omphalotaceae; Lentinula.
REFERENCE   1  (bases 1 to 3039)
  AUTHORS   Zhang,J., Shen,N., Li,C., Xiang,X., Liu,G., Gui,Y., Patev,S.,
            Hibbett,D.S., Barry,K., Andreopoulos,W., Lipzen,A., Riley,R.,
            He,G., Yan,M., Grigoriev,I.V., Shan Kwan,H., Kit Cheung,M., Bian,Y.
            and Xiao,Y.
  TITLE     Population genomics provides insights into the genetic basis of
            adaptive evolution in the mushroom-forming fungus Lentinula edodes
  JOURNAL   J Adv Res (2021) In press
  REMARK    DOI: 10.1016/j.jare.2021.09.008
REFERENCE   2  (bases 1 to 3039)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (14-MAR-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3039)
  AUTHORS   Haridas,S., Zhang,J., Li,C., Xiang,X., Liu,G., Shen,N., Gui,Y.,
            Patev,S., Hibbett,D.S., Grigoriev,I.V., Barry,K., Andreopoulos,W.,
            Lipzen,A., Riley,R., He,G., Yan,M., Kwan,H.S., Cheung,M.K., Bian,Y.
            and Xiao,Y.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (01-JUN-2020) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_025764348).
            
            ##Metadata-START##
            Organism Display Name :: Lentinula edodes Le(Bin) 0899 ss11
            ##Metadata-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..3039
                     /organism="Lentinula edodes"
                     /mol_type="mRNA"
                     /strain="Le(Bin) 0899 ss11"
                     /db_xref="taxon:5353"
                     /chromosome="Unknown"
                     /country="Russia: Primorsky"
     gene            <1..>3039
                     /locus_tag="C8R40DRAFT_1162984"
                     /db_xref="GeneID:70260687"
     CDS             1..3039
                     /locus_tag="C8R40DRAFT_1162984"
                     /codon_start=1
                     /product="NRDE-2, necessary for RNA
                     interference-domain-containing protein"
                     /protein_id="XP_046081836.1"
                     /db_xref="GeneID:70260687"
                     /db_xref="InterPro:IPR013633"
                     /db_xref="JGIDB:Lenedo1_1162984"
                     /translation="
MSFAPSFSSFPSFDSFPDSRPSQIPKLQTEEKSKKKKKTKARNSKDKESKREGRSAQFKDTFDASSRAKAEEPTEFYFSDRTGDSGNIQYGKLSSSSIPKYFVVGRGRIILGLSPIITAFSRRSQSLKLLSIPPQRRLTADSKSTKYQERDGFLLLGQGRRSRTGDPSYRAITQEDNSDSDSDSVVSIFSSSEDERTLSAHEETLRGLEQQLSADPSSITNWLRLLSQTLSTTSVATQEARKARSKITIPLLSRALAAHPANSTSPLLRIKYLRAIEDVWSESQCDSEWEDALKLGNIDMWMEWLEWRISKSTDGLDGVIDAALRILSSLDDSEDSEVGKLRVFWRIAIVFKQAGYHERATAMFQAQAEFVFANPQALNGVPLEIRLAAFEEFWDSEVPRIGELHSKGWSHWVSHKQERNPLTVVTSSVTPTSTELDPYRQWAEYETRADCAGQLPARTIDDNIDSDPYSTILFVDIRPFLFDLRTQRSKNVFRLAWLSTLGLHIPGFSASLSSSGDSRDDRWSYIHLTKPAFLDAILPTAGAQNVSLTADALAGALVGRQKVYKQSFGPIKNWSLGSFHLFDPVYGTTGMWNTLDIADVDAAFVSRVFSSLRLGPEDTDWDSLSLAFETALSVKSALKLSRSFLASDRDSLPRWAAHAQLERIRGKSDEARKVYQTVLIASAKPIPRPCEGHLWSDWADMEWLAGQEEDALSVICRAARVEGQGSLAVLRTRRALNEFGKDCTSWREREAWIKLGALLVILTSHNIQNALSIFDAQLNEIRPRDTAHESLTMTCLMFIYRYGSVLKNPVPPSILRERVLQSMAYYPHNSVILALFLEVEKGQGVWGRIRGTLGDNSENLKDVARRVQEVWIAGWESGRWEAEIERTRIGLSGAVEHERTRGCSQIWIIYIEFEIRAKQYKQAKNLFYQAIGQCPRYLYLLAFGSLRGVFDGRELDALAETMAERDIRMRKGLDEVLEEWEPEKQKNDEPVNNNEDDEIEYNAKELRRLRPY"
ORIGIN      
atgtcttttgcaccctcgttcagctcttttccatcgtttgattcatttcctgactctaggcccagccagattcctaaactgcagacggaagaaaaatcgaaaaagaaaaagaagacaaaggcccgcaactcaaaggacaaggaatcgaagcgtgaaggccgttctgcacaattcaaggacaccttcgacgcgtcttcgagagcaaaggctgaagagccaacagagttttacttctcagatcgcacaggggactctgggaacattcaatatggcaagctctcgtcaagctcaataccaaaatacttcgtcgtcggccgaggtagaataatactcggactttcacccattatcaccgctttctcgcgtcgaagccagtccctcaagctactgtctatccccccgcaacggaggctaactgcagatagcaaatccacaaaatatcaagaaagagacggatttcttcttctaggacaaggtcgtaggtctcgtaccggcgatccttcctaccgcgccatcactcaagaagataactccgattctgattccgattctgtcgtctctattttcagcagctctgaagacgagcgtactctcagtgctcatgaggagacattgaggggccttgaacagcagctttctgcggatccatcgtccattaccaattggttgcgtttgctttctcagacgttatcgacaaccagcgtcgccacacaggaagcacggaaagcgcgctcaaagatcacaattcctttactttcacgcgcactagctgcacaccccgcgaatagcacctccccattgttgcgaataaaataccttagagccatagaagatgtgtggagtgagtcccaatgcgattctgaatgggaggatgcgctgaaactgggaaacattgacatgtggatggaatggctcgagtggcgaatctctaaaagtactgatggattagatggagtcatcgatgctgctctgcgcatattgtcttcactcgatgactctgaggattcagaagtggggaagttaagggttttctggagaatcgcaatagttttcaagcaggcaggatatcatgagcgcgctaccgccatgtttcaggcgcaagctgagtttgtctttgcaaatccacaagcactgaatggtgtaccgctcgaaattcgactggctgccttcgaagaattttgggattcggaagttccccggataggcgagctccattccaaaggttggtcgcactgggtctcacacaagcaagaacgcaatcctcttacagtcgtcacttcgtctgtcactcctacatctactgaacttgatccctatcgtcagtgggctgaatatgaaactcgagctgactgtgcaggacagcttcctgcacgtacgattgacgataacatcgactcggatccttactctacgattctttttgtggatattcgaccttttctttttgacctgcggacacagcgctccaagaacgtctttcgccttgcgtggctttcgacccttggtctacacatacctggattttcggcttcgttgtcgagttctggagacagccgggatgatcgatggagctacattcatcttaccaagcccgcatttctcgatgcaatactccccacggcgggcgctcagaacgtatcattaacggcggatgccttagcaggtgctctagtcggcagacaaaaagtttacaagcaaagttttggtcctataaagaattggtctttgggctctttccacttatttgacccggtatatggaaccacaggaatgtggaatacattggatatcgctgacgtggacgctgcctttgtgagcagagtattttcctctctgcgactaggcccagaggatacagattgggattcactctcattggcctttgaaaccgcattgagcgtaaaaagtgcccttaaactttctcgctcttttcttgcctccgatcgcgattctcttccacgttgggcagcacatgcgcaattagagaggatacgtggaaaatcagacgaggctcgcaaagtatatcaaaccgtcctcattgcttcggcgaaacccataccacgcccctgtgagggtcatttgtggtcggattgggctgatatggagtggctagccggccaggaggaagatgccctatcagtaatttgtcgtgccgcgagggtcgaaggccaaggaagtctggcagtccttcgcactaggcgggcgctgaacgaatttggcaaagattgtacttcttggcgggagagggaggcatggatcaagcttggtgccctgttagtcattttgacctcacataacatacaaaatgcgctttctatcttcgatgcccagctcaatgaaatcaggccccgcgatacggcgcacgaaagcttgactatgacatgcctaatgttcatctatcgatatggatcagtcttgaagaatccagtgccaccatcgatattacgggagcgggtgcttcaatcaatggcgtactatccccacaactctgttatactcgcactattcctggaagtcgaaaagggccaaggtgtttgggggcggatacgaggaaccctaggcgataacagtgaaaatctaaaagatgtggcgagaagggtacaagaggtatggattgcgggatgggaaagtggcagatgggaggctgaaatcgaacgtactcgcattggtttgtccggcgcggtggagcacgaaaggactagggggtgttcccagatatggataatctacattgagttcgaaatacgggcaaaacagtataagcaagcaaaaaatcttttctaccaagcaattgggcaatgtccacgctatttgtatttgctggcatttggatctctcagaggtgtatttgatggcagggaactggatgcattggcagaaacaatggcagagagggatattcggatgcgaaaaggattggatgaagttttggaagaatgggagccagagaaacaaaagaatgatgagccagtgaacaacaatgaagatgatgaaatagagtacaatgcgaaggaattgagaagactacgaccgtactga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]