2024-04-26 12:16:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_046230320 3039 bp mRNA linear PLN 14-MAR-2022 DEFINITION Lentinula edodes NRDE-2, necessary for RNA interference-domain-containing protein (C8R40DRAFT_1162984), partial mRNA. ACCESSION XM_046230320 VERSION XM_046230320.1 DBLINK BioProject: PRJNA801212 BioSample: SAMN08778769 KEYWORDS RefSeq. SOURCE Lentinula edodes (shiitake mushroom) ORGANISM Lentinula edodes Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Marasmiineae; Omphalotaceae; Lentinula. REFERENCE 1 (bases 1 to 3039) AUTHORS Zhang,J., Shen,N., Li,C., Xiang,X., Liu,G., Gui,Y., Patev,S., Hibbett,D.S., Barry,K., Andreopoulos,W., Lipzen,A., Riley,R., He,G., Yan,M., Grigoriev,I.V., Shan Kwan,H., Kit Cheung,M., Bian,Y. and Xiao,Y. TITLE Population genomics provides insights into the genetic basis of adaptive evolution in the mushroom-forming fungus Lentinula edodes JOURNAL J Adv Res (2021) In press REMARK DOI: 10.1016/j.jare.2021.09.008 REFERENCE 2 (bases 1 to 3039) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (14-MAR-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 3039) AUTHORS Haridas,S., Zhang,J., Li,C., Xiang,X., Liu,G., Shen,N., Gui,Y., Patev,S., Hibbett,D.S., Grigoriev,I.V., Barry,K., Andreopoulos,W., Lipzen,A., Riley,R., He,G., Yan,M., Kwan,H.S., Cheung,M.K., Bian,Y. and Xiao,Y. CONSRTM DOE Joint Genome Institute TITLE Direct Submission JOURNAL Submitted (01-JUN-2020) DOE Joint Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598-1698, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NW_025764348). ##Metadata-START## Organism Display Name :: Lentinula edodes Le(Bin) 0899 ss11 ##Metadata-END## COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..3039 /organism="Lentinula edodes" /mol_type="mRNA" /strain="Le(Bin) 0899 ss11" /db_xref="taxon:5353" /chromosome="Unknown" /country="Russia: Primorsky" gene <1..>3039 /locus_tag="C8R40DRAFT_1162984" /db_xref="GeneID:70260687" CDS 1..3039 /locus_tag="C8R40DRAFT_1162984" /codon_start=1 /product="NRDE-2, necessary for RNA interference-domain-containing protein" /protein_id="XP_046081836.1" /db_xref="GeneID:70260687" /db_xref="InterPro:IPR013633" /db_xref="JGIDB:Lenedo1_1162984" /translation="
MSFAPSFSSFPSFDSFPDSRPSQIPKLQTEEKSKKKKKTKARNSKDKESKREGRSAQFKDTFDASSRAKAEEPTEFYFSDRTGDSGNIQYGKLSSSSIPKYFVVGRGRIILGLSPIITAFSRRSQSLKLLSIPPQRRLTADSKSTKYQERDGFLLLGQGRRSRTGDPSYRAITQEDNSDSDSDSVVSIFSSSEDERTLSAHEETLRGLEQQLSADPSSITNWLRLLSQTLSTTSVATQEARKARSKITIPLLSRALAAHPANSTSPLLRIKYLRAIEDVWSESQCDSEWEDALKLGNIDMWMEWLEWRISKSTDGLDGVIDAALRILSSLDDSEDSEVGKLRVFWRIAIVFKQAGYHERATAMFQAQAEFVFANPQALNGVPLEIRLAAFEEFWDSEVPRIGELHSKGWSHWVSHKQERNPLTVVTSSVTPTSTELDPYRQWAEYETRADCAGQLPARTIDDNIDSDPYSTILFVDIRPFLFDLRTQRSKNVFRLAWLSTLGLHIPGFSASLSSSGDSRDDRWSYIHLTKPAFLDAILPTAGAQNVSLTADALAGALVGRQKVYKQSFGPIKNWSLGSFHLFDPVYGTTGMWNTLDIADVDAAFVSRVFSSLRLGPEDTDWDSLSLAFETALSVKSALKLSRSFLASDRDSLPRWAAHAQLERIRGKSDEARKVYQTVLIASAKPIPRPCEGHLWSDWADMEWLAGQEEDALSVICRAARVEGQGSLAVLRTRRALNEFGKDCTSWREREAWIKLGALLVILTSHNIQNALSIFDAQLNEIRPRDTAHESLTMTCLMFIYRYGSVLKNPVPPSILRERVLQSMAYYPHNSVILALFLEVEKGQGVWGRIRGTLGDNSENLKDVARRVQEVWIAGWESGRWEAEIERTRIGLSGAVEHERTRGCSQIWIIYIEFEIRAKQYKQAKNLFYQAIGQCPRYLYLLAFGSLRGVFDGRELDALAETMAERDIRMRKGLDEVLEEWEPEKQKNDEPVNNNEDDEIEYNAKELRRLRPY"
ORIGIN
atgtcttttgcaccctcgttcagctcttttccatcgtttgattcatttcctgactctaggcccagccagattcctaaactgcagacggaagaaaaatcgaaaaagaaaaagaagacaaaggcccgcaactcaaaggacaaggaatcgaagcgtgaaggccgttctgcacaattcaaggacaccttcgacgcgtcttcgagagcaaaggctgaagagccaacagagttttacttctcagatcgcacaggggactctgggaacattcaatatggcaagctctcgtcaagctcaataccaaaatacttcgtcgtcggccgaggtagaataatactcggactttcacccattatcaccgctttctcgcgtcgaagccagtccctcaagctactgtctatccccccgcaacggaggctaactgcagatagcaaatccacaaaatatcaagaaagagacggatttcttcttctaggacaaggtcgtaggtctcgtaccggcgatccttcctaccgcgccatcactcaagaagataactccgattctgattccgattctgtcgtctctattttcagcagctctgaagacgagcgtactctcagtgctcatgaggagacattgaggggccttgaacagcagctttctgcggatccatcgtccattaccaattggttgcgtttgctttctcagacgttatcgacaaccagcgtcgccacacaggaagcacggaaagcgcgctcaaagatcacaattcctttactttcacgcgcactagctgcacaccccgcgaatagcacctccccattgttgcgaataaaataccttagagccatagaagatgtgtggagtgagtcccaatgcgattctgaatgggaggatgcgctgaaactgggaaacattgacatgtggatggaatggctcgagtggcgaatctctaaaagtactgatggattagatggagtcatcgatgctgctctgcgcatattgtcttcactcgatgactctgaggattcagaagtggggaagttaagggttttctggagaatcgcaatagttttcaagcaggcaggatatcatgagcgcgctaccgccatgtttcaggcgcaagctgagtttgtctttgcaaatccacaagcactgaatggtgtaccgctcgaaattcgactggctgccttcgaagaattttgggattcggaagttccccggataggcgagctccattccaaaggttggtcgcactgggtctcacacaagcaagaacgcaatcctcttacagtcgtcacttcgtctgtcactcctacatctactgaacttgatccctatcgtcagtgggctgaatatgaaactcgagctgactgtgcaggacagcttcctgcacgtacgattgacgataacatcgactcggatccttactctacgattctttttgtggatattcgaccttttctttttgacctgcggacacagcgctccaagaacgtctttcgccttgcgtggctttcgacccttggtctacacatacctggattttcggcttcgttgtcgagttctggagacagccgggatgatcgatggagctacattcatcttaccaagcccgcatttctcgatgcaatactccccacggcgggcgctcagaacgtatcattaacggcggatgccttagcaggtgctctagtcggcagacaaaaagtttacaagcaaagttttggtcctataaagaattggtctttgggctctttccacttatttgacccggtatatggaaccacaggaatgtggaatacattggatatcgctgacgtggacgctgcctttgtgagcagagtattttcctctctgcgactaggcccagaggatacagattgggattcactctcattggcctttgaaaccgcattgagcgtaaaaagtgcccttaaactttctcgctcttttcttgcctccgatcgcgattctcttccacgttgggcagcacatgcgcaattagagaggatacgtggaaaatcagacgaggctcgcaaagtatatcaaaccgtcctcattgcttcggcgaaacccataccacgcccctgtgagggtcatttgtggtcggattgggctgatatggagtggctagccggccaggaggaagatgccctatcagtaatttgtcgtgccgcgagggtcgaaggccaaggaagtctggcagtccttcgcactaggcgggcgctgaacgaatttggcaaagattgtacttcttggcgggagagggaggcatggatcaagcttggtgccctgttagtcattttgacctcacataacatacaaaatgcgctttctatcttcgatgcccagctcaatgaaatcaggccccgcgatacggcgcacgaaagcttgactatgacatgcctaatgttcatctatcgatatggatcagtcttgaagaatccagtgccaccatcgatattacgggagcgggtgcttcaatcaatggcgtactatccccacaactctgttatactcgcactattcctggaagtcgaaaagggccaaggtgtttgggggcggatacgaggaaccctaggcgataacagtgaaaatctaaaagatgtggcgagaagggtacaagaggtatggattgcgggatgggaaagtggcagatgggaggctgaaatcgaacgtactcgcattggtttgtccggcgcggtggagcacgaaaggactagggggtgttcccagatatggataatctacattgagttcgaaatacgggcaaaacagtataagcaagcaaaaaatcttttctaccaagcaattgggcaatgtccacgctatttgtatttgctggcatttggatctctcagaggtgtatttgatggcagggaactggatgcattggcagaaacaatggcagagagggatattcggatgcgaaaaggattggatgaagttttggaagaatgggagccagagaaacaaaagaatgatgagccagtgaacaacaatgaagatgatgaaatagagtacaatgcgaaggaattgagaagactacgaccgtactga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]