LOCUS       XM_045476709            2481 bp    mRNA    linear   MAM 17-DEC-2021
DEFINITION  PREDICTED: Leopardus geoffroyi argonaute RISC catalytic component 3
            (AGO3), transcript variant X6, mRNA.
ACCESSION   XM_045476709
VERSION     XM_045476709.1
DBLINK      BioProject: PRJNA786922
KEYWORDS    RefSeq.
SOURCE      Leopardus geoffroyi (Geoffroy's cat)
  ORGANISM  Leopardus geoffroyi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae;
            Felinae; Leopardus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_059328) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Leopardus geoffroyi Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2481
                     /organism="Leopardus geoffroyi"
                     /mol_type="mRNA"
                     /isolate="Oge1"
                     /db_xref="taxon:46844"
                     /chromosome="C1"
                     /sex="male"
                     /cell_type="Fibroblast"
                     /tissue_type="Fibroblast"
                     /dev_stage="adult"
     gene            1..2481
                     /gene="AGO3"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 11 long SRA reads, 3 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 8 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:123597600"
     CDS             104..1984
                     /gene="AGO3"
                     /codon_start=1
                     /product="protein argonaute-3 isoform X5"
                     /protein_id="XP_045332665.1"
                     /db_xref="GeneID:123597600"
                     /translation="

MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"

     misc_feature    104..445
                     /gene="AGO3"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(239..241,284..286,326..328,338..340,392..394,
                     413..415,419..421)
                     /gene="AGO3"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    578..1855
                     /gene="AGO3"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(989..991,1001..1003,1037..1048,1055..1057,
                     1079..1081,1088..1090,1100..1102,1112..1114)
                     /gene="AGO3"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(1193..1195,1199..1201,1409..1411,1823..1825)
                     /gene="AGO3"
                     /note="active site"
                     /db_xref="CDD:240015"
     polyA_site      2481
                     /gene="AGO3"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      

agaggagaaaaaactaatctcaggagccagttaggaggctttttcaatccctagttcagtttctgccactgccttctacaaagcacaacctgtaattcaattcatgtgtgaagttcttgacattcataatattgatgagcaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaaaggtctgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaagaaggcctgccagtcatcaaacctttcctttacagttagaaaatggccaaactgtggagagaacagtagcacagtatttcagagaaaagtatactcttcagctgaagtacccacaccttccttgtctgcaagtggggcaggaacagaaacatacctacctgccactagaagtctgtaatatcgtggccgggcaacgatgtatcaagaagctaacggacaatcagacttccactatgatcaaagcaacagcaagatctgcgccagatagacaagaggagattagcagattggtaagaagtgcaaattatgaaacagatccatttgttcaggagtttcagtttaaagttcgggatgaaatggcccatgtaaccggacgtgtactcccagcacctatgctgcagtatggaggacggaatcggacagtagcaacaccaagccatggagtatgggacatgcgagggaaacagttccatacaggagttgaaataaaaatgtgggctatagcttgtttcgccacacagaggcagtgcagagaagaaatcttgaagggtttcacggaccagctgcgtaagatttctaaagatgcagggatgcccatccagggccagccttgcttctgcaaatacgcgcagggggcggacagcgtggagcccatgttccggcatctcaagaacacctactcagggctgcagctcattatcgtcatcctgccagggaagacgccagtgtatgctgaagtgaaacgtgtaggagatacacttttgggtatggctacgcagtgtgtccaagtcaagaatgtaataaaaacatcccctcaaactctctcaaacttgtgcctaaagataaatgttaaactcggagggatcaataatattcttgtacctcatcaaagaccttctgtgttccagcaacccgtgatctttttgggagcagatgtcactcatccaccagctggtgatgggaagaagccttctattgctgctgttgtaggtagtatggatgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcttccatggttcgagaacttctcattcaattttataagtcaactcggttcaaacctactcgtatcatcttttatcgggatggtgtttcagagggacagtttaggcaggtattatattatgaactactagcaattcgagaagcctgcatcagtttggaaaaagactatcaacctggaataacctacattgtagttcagaagagacatcacactcgattgttttgtgctgataggacagaaagggttggaagaagtggcaatatcccagctggaacaacagttgatacagacattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccttcacactatcatgttttatgggacgataactgctttactgcagatgaacttcagctgctgacttaccagctctgccacacttacgtgcgctgtacacgatctgtttctatacctgcaccagcgtattatgctcacctggtagcgttcagagccagataccatctcgtggacaaagaacatgacagtgctgaaggaagtcatgtttcaggacagagcaatggacgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaaaagtccaagaatattctctgagaggaagaattgaaagatgcatcgacatagagcgtatgtttccagtggagtcagttgagtgggaatgcctccagccatacagcaaccaacactgtgtggggaccagggtctgatttttatgttaatataaggaagattgtttacttcatcaaggaacacagcaccattatgcaatatgaaaccagccaactgcttttttgtgcggtctccttaggaagtatcgccattgttttgttttcactttcttgtagtctaacccttttaatgcctttacctcaagttgcttggcagcacaactatctttgcaaaaaaagtacagaaaaagtaaatgacggtttaaaaaaaaaacacacacaccttacatgaataatcaaagtgattgttcacaattatgtgtgcaaaaaaattaatgtgcattcgtgtattcttgtgaaaggtatctgtgtatattttaaatatatacatgtatacttca

//