LOCUS       XM_045404442            2934 bp    mRNA    linear   PLN 26-FEB-2022
DEFINITION  Colletotrichum gloeosporioides Protein argonaute (GCG54_00004393),
            partial mRNA.
ACCESSION   XM_045404442
VERSION     XM_045404442.1
DBLINK      BioProject: PRJNA786947
            BioSample: SAMN13038012
KEYWORDS    RefSeq.
SOURCE      Colletotrichum gloeosporioides
  ORGANISM  Colletotrichum gloeosporioides
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Sordariomycetes; Hypocreomycetidae; Glomerellales; Glomerellaceae;
            Colletotrichum; Colletotrichum gloeosporioides species complex.
REFERENCE   1  (bases 1 to 2934)
  AUTHORS   Fu,F.F., Hao,Z., Wang,P., Lu,Y., Xue,L.J., Wei,G., Tian,Y.,
            Baishi,H., Xu,H., Shi,J., Cheng,T., Wang,G., Yi,Y. and Chen,J.
  TITLE     Genome sequence and comparative analysis of Colletotrichum
            gloeosporioides isolated from Liriodendron leaves
  JOURNAL   Phytopathology (2020) In press
   PUBMED   32202483
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 2934)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (25-FEB-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 2934)
  AUTHORS   Fu,F.-F. and Chen,J.
  TITLE     Direct Submission
  JOURNAL   Submitted (27-MAR-2020) College of Forestry, Nanjing Forestry
            University, 159 Longpan Road, Nanjing, Jiangsu 210037, China
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_025544682).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..2934
                     /organism="Colletotrichum gloeosporioides"
                     /mol_type="mRNA"
                     /strain="Lc1"
                     /isolation_source="Liriodendron chinense"
                     /db_xref="taxon:474922"
                     /chromosome="Unknown"
                     /country="China: NFU, Nanjing"
                     /collection_date="2013-08-12"
     gene            <1..>2934
                     /locus_tag="GCG54_00004393"
                     /db_xref="GeneID:69011548"
     CDS             1..2934
                     /locus_tag="GCG54_00004393"
                     /codon_start=1
                     /product="Protein argonaute"
                     /protein_id="XP_045265226.1"
                     /db_xref="GeneID:69011548"
                     /translation="

MSSGSPARSRSGSQAAQRPNPFGPSMGFDPAKPEGGPEKDHKNTRIDLPAEAYTVGADRKNAGETPFAKRPGFNTAGKPCNLEVNQFRVKSWNDKATIHQYDVMISPTPMKYNVVFQKVWKHPTVQAMLKKYKCLWLCDGRKLAWAPVAINRGEERLTIDLDEGLPPPKSGKPRRKDENKFFFVIRQTKQIHLSALEAYLNNRMDWDNSVLEAMNFLDHLVRQYPTENLLSIKRNFYNEHRKKAFDLGNCIELVKGVYASVRMNQSFSGSIGRGLGLNVDVANTAFWKGNMQLHMFVRSFLETCDKRWKNQSPDDIARLLAPVRQNSKNGAVFVMSDAFKHLRKLAKLRFTPRHRGKEDWAKVYVIKAIAFGQEYGERGATANNIKFTNNGEEMTVAEYFQKTYGFKLQFPNWPLIETQKAGFFPMEVCIIKPMQRYPYKLGPDETAMMIKGAVTRPNVRKADIMEAKAQLAWKDDPYLKQYGVVFDEAMAKTQGCLLEPPKIQYANNVVSPMFAGRWDLRGKKFWVGNRQPLQSWGILILEDSTRKPAADQFVKMFKQTYTGHGGKILKDAVVIDSESRQGDMALALANGYKAIKKATGMTPQLIFCVLRFNNAGSYERIKKSADCRFGVLTQCVLARHVEKNQGQYHSNVAMKVNAKLGGITCRIPNQKLGPNSKAPAFFERVTMMIGVDVSHATPGIDAPSMATMTMSMDQDATFYAAAVDTNGYRVEMLSPVNTRNFLARLMPTWHKRMGHPAPPPHIIYFRDGVSEGQYAQVLEYEIGTLKAIFKEKYPGATLPRFTVIVATKRHHVRFFPQQGDKNGNPLPGTLLEKEVCHPFWWDFYLCSHVAIQGTARPVHYTVLVDEANMKPNDLQKMIYGQCYQYARSTTPVSLHPAIYYADLAAGRARAHENIATSQGFRSGPKAAEMVEEYGARGQSMFDGDRPTEALQLLPLGGTSGDADPASTEMFRNTMWYI"

     misc_feature    415..663
                     /locus_tag="GCG54_00004393"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:435368"
     misc_feature    691..864
                     /locus_tag="GCG54_00004393"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:430160"
     misc_feature    973..1293
                     /locus_tag="GCG54_00004393"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1090..1092,1159..1161,1186..1188,1198..1200,
                     1252..1254,1264..1266,1270..1272)
                     /locus_tag="GCG54_00004393"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1429..2736
                     /locus_tag="GCG54_00004393"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(1852..1854,1864..1866,1900..1911,1918..1920,
                     1942..1944,1951..1953,1963..1965,1975..1977)
                     /locus_tag="GCG54_00004393"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2074..2076,2080..2082,2299..2301,2704..2706)
                     /locus_tag="GCG54_00004393"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      

atgtcttccggcagccccgctcgttctcgctccggctcccaggccgcccagcgtcccaaccccttcggcccttcgatgggcttcgacccggccaagcctgagggcggtcctgagaaggaccacaagaacactcgaatcgacttgcctgcggaggcgtacaccgtcggcgcggatagaaaaaacgccggcgagacgcctttcgccaagcgccctggattcaacacggccggcaagccttgcaaccttgaggtcaaccagttccgagtcaagtcctggaacgacaaagccaccattcaccagtacgatgttatgatctcgcctaccccgatgaagtacaatgtcgtcttccagaaggtctggaagcatcccacggtccaagcgatgctcaagaagtacaagtgcctgtggctctgcgacggtcgcaagctcgcctgggctcctgttgccatcaaccgcggtgaggagcgtctcaccatcgaccttgatgagggccttccccctcccaagagcggcaagccccgccgtaaggatgagaacaagttcttcttcgtcattcgtcagacgaagcaaattcatctgtctgccctggaggcctacctcaacaaccgcatggactgggacaactccgtccttgaggcgatgaacttcctggatcacctggtccggcagtaccccacggaaaacctcctctccatcaagcgcaacttttacaacgagcatcgcaagaaggccttcgaccttggcaactgcatcgagcttgtcaagggtgtgtacgcgtccgttcgcatgaaccagtccttcagcggtagcattggtcgaggacttggactgaatgtggacgtcgccaacactgccttctggaagggcaacatgcagttgcacatgttcgtccgttccttcctcgagacctgcgacaagagatggaagaaccagagccccgatgacattgccaggcttcttgcgcccgtccgccaaaacagcaagaacggcgccgtcttcgtcatgtctgacgctttcaagcacctgcgcaagctggccaagctgcgtttcacccctcgccatcggggcaaggaggactgggcgaaggtgtacgtaatcaaggccatcgcattcgggcaggaatacggcgagagaggcgccaccgccaacaacatcaagttcaccaacaacggcgaggaaatgacggtcgcagagtacttccagaagacctacggcttcaagcttcagttccccaactggcccctcatcgagactcagaaggccggcttcttccccatggaagtctgcattatcaagccaatgcagcgctacccctacaagttgggtcctgacgagacggctatgatgatcaagggcgccgtcacgcgtcccaacgtgcgcaaggcggacatcatggaggcgaaggcccagttggcgtggaaggatgacccctacctcaagcagtacggtgtcgtcttcgacgaggctatggcgaagacccaaggctgcttgcttgagccccccaaaatccagtatgcgaacaacgttgtcagccccatgttcgccggccgctgggaccttcgcggcaagaagttctgggtcggcaaccgccagcccctgcagtcctggggtattctcatccttgaggactccaccagaaagcccgctgccgaccagttcgtcaagatgttcaagcagacctacactggtcatggaggcaagattctgaaggacgctgttgtcattgacagcgagtctagacagggtgacatggccttggccttggccaacggctacaaggcgatcaagaaggctacgggcatgacgccccagctgatcttctgcgtcctgcgcttcaacaacgctggctcctacgagcgcatcaagaagtctgcggactgtcgcttcggcgtcctcacccagtgcgttcttgcccgccacgtcgagaagaaccaaggccagtaccactcgaatgtcgccatgaaggtcaatgccaagctgggcggtattacctgccgtatcccgaaccagaagcttggcccgaacagcaaggcgcctgccttcttcgaaagggtgacgatgatgattggcgtcgacgtctcccacgcgacccccggcatcgatgccccttccatggccacgatgactatgtccatggaccaggacgccaccttctacgccgctgcagtcgacaccaatggctaccgggttgagatgctctctcccgtcaacactcgcaacttcctggcccgcctgatgcctacctggcacaagcgcatgggtcacccggctcctcccccccacatcatctacttccgcgatggtgtctctgagggccagtacgcccaggttctcgaatacgagatcggcacgctgaaggccatcttcaaggagaaataccccggcgcgacccttcccaggttcaccgtcatcgtggctaccaagcgtcaccacgtccgcttcttcccccagcagggtgacaagaacggaaaccctctgcccggcacccttctcgagaaggaggtctgccaccccttctggtgggacttctatctctgctcgcacgtcgccatccagggcacggcccgccctgtccactacactgtgcttgtcgacgaggccaacatgaagcctaacgatctgcagaagatgatctacggccaatgctaccagtacgctcgtagcaccacccccgtctctctgcacccggccatctactatgccgacctggctgccggccgcgctcgtgcccacgagaacattgcaacttcccagggcttccgcagcggacccaaggcggccgagatggtcgaggagtacggcgctcgtggccagagcatgttcgacggcgacagacctaccgaagctctccagcttctgcccctcggcggcaccagtggtgatgccgaccccgcatcgaccgagatgttcaggaacaccatgtggtacatctaa

//