GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-18 10:09:28, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_044587492            2580 bp    mRNA    linear   PLN 18-APR-2025
DEFINITION  PREDICTED: Triticum aestivum ubiquitin-like-specific protease 1D
            (LOC123169622), transcript variant X2, mRNA.
ACCESSION   XM_044587492
VERSION     XM_044587492.1
DBLINK      BioProject: PRJNA764258
KEYWORDS    RefSeq.
SOURCE      Triticum aestivum (bread wheat)
  ORGANISM  Triticum aestivum
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
            clade; Pooideae; Triticodae; Triticeae; Triticinae; Triticum.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_057814.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_018294505.1-RS_2025_04
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 04/16/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2580
                     /organism="Triticum aestivum"
                     /mol_type="mRNA"
                     /cultivar="Chinese Spring"
                     /db_xref="taxon:4565"
                     /chromosome="7D"
                     /tissue_type="leaf"
                     /dev_stage="Vegetative"
                     /geo_loc_name="USA: Davis, California"
     gene            1..2580
                     /gene="LOC123169622"
                     /note="ubiquitin-like-specific protease 1D; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 5 ESTs, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 57 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:123169622"
     CDS             33..2291
                     /gene="LOC123169622"
                     /codon_start=1
                     /product="ubiquitin-like-specific protease 1D isoform X2"
                     /protein_id="XP_044443427.1"
                     /db_xref="GeneID:123169622"
                     /translation="
MPEAPAVSIVDFSSAASSFSSPTPTSPRPRPLGEPRRAAVNAMATASSEPLPSGEEGDEDAGARIDDDLRGMSDQALKERFKRLQDGLNKFPGVLPDGGKKYRRSLRAVRGELDRRTRLASDSASLRPRPRPPRPQGRLGEPDGNRGERMIQSSCAEPSGLSSKCNENHGVTKSDFLSAFEVDDEAGIDVEITSICPGKTKTPVENKGKSYAVSESCKTNAQPTPPKVLCIDNSIDVENMSSDDDFKDNGDIRTRENASTPSRKRKGDDSVNFSMRLRPRKAQEVVLLDADAHHSESAEKPTTKRDAMKIYYPSSEHSNSIELSHDDIKCLEPESLLSSTIMNFYIMYLQGPMSSISTQRGKYHIFNTYFFKKLEALKSKVDKPSYFLNLRRWWKGIDIFQKPYILFPVHADTHWSLVIICMPAKEDQSGPIILHLDSLKFHNSRLIFSVVERFLKQEWNYLKENGSLAECPIRETVWKKLPHKIEKKPIARFIEEAPERLHKKDLSMFGKTWFQPEEASALRKKMKTLLHQLFEEADPSNDSTSEQTACQLLLEAKPANNVMELATSEHPLEVSSAEVIPTSEHLLEVGSVEMTPMSEHPLEVGSAEMSPTQEHPLVCSSGEMAPAQEHPLVGSSAEMEPTQEHPLVGNSAEMEPKQEYPLVGSSAEMAPTQEHTLVGSSAEMAPTQEHPLVGSSAEMEPTQEHPTVGSSAEMEQTQGHPMVGSSAEITSQKPLEGTSTRPTSFEHPLECS"
     misc_feature    1041..>1421
                     /gene="LOC123169622"
                     /note="Ulp1 protease family, C-terminal catalytic domain;
                     Region: Peptidase_C48; cl23802"
                     /db_xref="CDD:420019"
     misc_feature    <1635..2195
                     /gene="LOC123169622"
                     /note="EBNA-3B; Provisional; Region: PHA03378"
                     /db_xref="CDD:223065"
     polyA_site      2580
                     /gene="LOC123169622"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
cgtttctttttgcgagaaggccctcctccaatatgccagaggccccggctgtcagcatcgtcgacttctcctccgccgcctcctctttctcttccccaaccccaacttcccctcgaccccgccccctcggcgagccgcgccgcgccgcggtgaatgcgatggccacggcttcgtcggagccgctccccagcggcgaggagggggacgaggatgcgggggcgaggatcgatgacgaccttcgcggcatgtcggaccaggcgctgaaggagaggttcaaacgcctacaggacgggctcaacaaattccccggcgtcctcccggacggtgggaagaagtaccgccgctcgctccgggccgtccgcggcgagctcgaccgccgcactcgcttggcctcggactcggcctctctccggccacggccgcggccgccgcgtccgcaaggccgcctaggcgagccggatggcaatagaggtgaacggatgatccagtcaagttgtgcagaaccgtctgggttgtctagtaaatgcaatgaaaatcatggagtaaccaaatctgatttcctttctgcatttgaggtggatgatgaggcaggcatcgatgtggagataacaagtatatgccctggcaagactaaaacgccagtagaaaataaagggaagtcgtatgcagtaagtgaatcttgcaaaaccaatgcacaaccaacgcctcccaaagtattatgtatcgacaactcaatcgacgtggaaaatatgtcttctgacgatgacttcaaggataacggcgatattaggacacgtgaaaatgcttccacaccttctcggaaaaggaaaggagatgactcagtaaacttctcaatgcgattgagaccaagaaaggctcaagaggtggttctactcgatgcagatgcacaccattcagaatctgcagagaagccaaccactaaacgggatgcaatgaagatatattatccctcaagcgaacactcaaattctattgagctttctcatgatgacataaaatgccttgagcctgaatcgttactttcctcaactataatgaacttctacattatgtacctgcaagggccaatgtcatcgattagtacacaaagaggcaagtatcacattttcaatacatacttcttcaagaaacttgaagccctaaaatcaaaggtagacaagccttcttatttcttaaacctgagaagatggtggaaaggcatagatatatttcaaaagccatatatattatttcctgtgcatgcagatactcattggagcctggtgattatatgcatgccagcaaaggaagatcaatcaggccccattatacttcatttggattcactgaagttccataacagcagattgattttcagtgttgttgagagattcttaaaacaagaatggaattacctgaaggaaaatgggtctttagcagaatgtcctatacgagaaacggtgtggaagaaacttcctcataaaattgagaagaaaccaattgcgcggttcatcgaggaggcacctgaaaggcttcacaagaaagacctttctatgtttggcaaaacatggtttcaacctgaagaggcttctgcattgcgaaagaaaatgaagaccctgcttcatcagttgtttgaggaagcggatcccagtaacgatagtacatcggagcagacagcgtgtcagttgcttttggaagctaagcctgcaaacaacgtgatggagctggcaacgtcagaacaccctttggaagtcagttcagctgaggtgataccaacgtcggaacacctgctggaagtcggttctgttgagatgacaccaatgtctgaacaccctttggaggtcggttctgctgagatgtcaccaacgcaagaacatcctttggtgtgcagttctggtgagatggcaccagcgcaagaacatcctttggtgggcagttcggctgagatggaaccaacacaagaacatcctttggtgggcaattcggctgagatggaaccaaagcaagaatatcctttggttggcagttcggctgagatggcaccaacgcaagaacataccttggtgggcagttcggctgagatggcaccaacgcaagaacatcccttggtgggcagttcggccgagatggaaccaacgcaagaacatcctacggtgggcagttccgccgagatggaacaaacgcaaggacatcctatggtgggcagttccgccgagattacatcgcagaaacctttggaaggcacttcgacccgaccaactagttttgagcaccctttggaatgcagctgattgatgttaccacctttggagcgacctacgttacccgtagaaaccgaaaccggctcggaattgtattatagatgggaaggtgttgtagcctgcatctgtgggcaactttgagggaggggtggtgttgcatgactgaacgttgcagttaatgtatccgcgggaactaccgtgtatatataatatcagtaggagaaatggtgggtgtacgagtcgctcaggatggacttcatctgtttagttatttataggctaggctggaagaggtcaataaaatctcaggctctgatta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]