2024-04-30 03:27:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_044570587 2583 bp mRNA linear PLN 25-OCT-2021 DEFINITION PREDICTED: Triticum aestivum ubiquitin-like-specific protease 1D (LOC123150756), transcript variant X1, mRNA. ACCESSION XM_044570587 VERSION XM_044570587.1 DBLINK BioProject: PRJNA764258 KEYWORDS RefSeq. SOURCE Triticum aestivum (bread wheat) ORGANISM Triticum aestivum Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Pooideae; Triticodae; Triticeae; Triticinae; Triticum. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_057812.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Triticum aestivum Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2583 /organism="Triticum aestivum" /mol_type="mRNA" /cultivar="Chinese Spring" /db_xref="taxon:4565" /chromosome="7A" /tissue_type="leaf" /dev_stage="Vegetative" /country="USA: Davis, California" gene 1..2583 /gene="LOC123150756" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 96 samples with support for all annotated introns" /db_xref="GeneID:123150756" CDS 33..2291 /gene="LOC123150756" /codon_start=1 /product="ubiquitin-like-specific protease 1D isoform X1" /protein_id="XP_044426522.1" /db_xref="GeneID:123150756" /translation="
MPEAPAASPVDFSAASSFSSPTPTSPRPRPLGEPRRAAVNAMATASSEPLPSGEEGDEDAGARIDDDLRGMSDQALKERFKRLQDGLNKFPGVLPDGGKKYRRSLRAVRGELDRRTRLASDSASLRPRPRPPRPQGRLGEPDGNRGERMIQSSCAEPSGLSSKCNENHGVTKSDFLSAFEVDDEAGIDVEITSICPGKTKTPVENKGKSYEVSESCKTNAQPMPPKVLCIDNSIDVENMSSDDDFKDNDDIRIRENASTPSRKRKGDDSVNFSMRLRPRKAQEVVLLDADAHHSESAEKPTTKRDAMKIYYPSSEHSNSIELSHDDIKCLEPESLLSSTIMNFYIMYLQGPMSSISTQRGKYHIFNTYFFKKLEALKSKADKPSYFLNLRRWWKGIDIFQKPYILFPVHADTHWSLVIICMPAKEDQSGPIILHLDSLNFHNSRLIFSVVERFLKQEWNYLKENGSLAECPIRETVWKKLPRKIEKKPIAVPQQENEFDCGLFVLYYMQRFIEEAPERLHKKDLSMFGKTWFQPEEASALRKKMKTLLHQLFEEADPSNDSTSEQTACQSLLEVKPANNVMELATSEHPLEVSSAEVIPTSEHLLEVGSAEMTPMSEHPLQVSSAEMSPTQEHPLVGSSGEMVPAQEHPLVGSLAEMEPTQEHPLVGNSAEMEPKPLVGSSAEMAPTQEHTFVGSSAEMAPTQEHPLVRSSAEMEPTQEHPMVGSSAEITSQKPLEGTSTRPTSFEHPLECS"
misc_feature <810..1604 /gene="LOC123150756" /note="Protease, Ulp1 family [Posttranslational modification, protein turnover, chaperones]; Region: ULP1; COG5160" /db_xref="CDD:227489" polyA_site 2583 /gene="LOC123150756" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
cgtttctttttgcgagaaggccctcctccaatatgccagaggccccggctgccagccccgtcgacttctccgccgcctcctctttctcttccccaaccccaacttcccctcgaccccgccccctcggcgagccgcgccgcgccgcggtgaatgcgatggccacggcttcgtcggagccgctccccagcggcgaggagggggacgaggatgcgggggcgaggatcgatgacgaccttcgcggcatgtcggaccaggcgctgaaggagaggttcaaacgcctacaggacgggctcaacaaattccccggcgtcctcccggacggtgggaagaagtaccgccgctcgctccgcgccgtccgcggcgagctcgaccgccgcactcgcttggcctcggactcggcctctctccggccacggccgcggccaccgcgtccgcaaggccgcctaggcgagccggatggcaatagaggtgaacggatgatccagtcaagttgtgcagaaccgtctggtttgtctagtaaatgcaatgaaaatcatggagtaaccaaatctgatttcctttccgcatttgaggtggatgatgaggcaggcatcgatgtggagataacaagtatatgccctggcaagactaaaacgccagtagaaaataaagggaagtcgtatgaagtgagtgaatcttgcaaaaccaatgcacaaccaatgcctcccaaagtattatgtatcgacaactcaatcgacgtggaaaatatgtcttctgacgatgacttcaaggataacgacgatattaggatacgtgaaaatgcttccacaccttctcggaaaaggaaaggagatgactcagttaacttctcaatgcgattgagaccaagaaaggctcaagaggtggttctactcgatgcagatgcacaccattcagaatctgcagagaagccaaccactaaacgggatgcaatgaagatatattatccttcaagcgaacactcaaattctattgagctttctcatgatgacataaaatgccttgagcctgaatcgttactttcctcaactataatgaacttctacattatgtacctgcaaggaccaatgtcgtcgattagtacacaaagaggcaagtatcacattttcaatacatacttcttcaagaaacttgaagccctaaaatcaaaggcagacaagccttcttacttcttaaacctgagaagatggtggaaaggcatagatatatttcaaaagccatatatattatttcctgtgcatgcagatactcattggagcctggtgattatatgcatgccagcaaaggaagatcaatcaggccccattatacttcatttggattcactgaatttccataacagcagattgattttcagtgttgttgagagattcttaaaacaagaatggaattacctgaaggaaaatgggtctttagcagaatgtcctatacgagaaacagtgtggaagaaacttcctcgtaaaattgagaagaaaccaattgcggttccccagcaggaaaatgaatttgactgtggcctctttgttctgtactatatgcagcggttcatcgaggaggcacctgaaaggcttcacaagaaagacctttctatgtttggcaaaacatggtttcaacctgaagaggcttctgcattgcgaaagaaaatgaagaccctgcttcatcagttgtttgaggaagcggatcccagtaacgacagtacatcggagcagacagcgtgtcagtcgcttttggaagttaagcctgcaaacaacgtgatggagctggcaacgtcagaacaccctttggaagtcagttcagctgaggtgataccaacgtcggaacacctgctggaagtcggttctgctgagatgacaccaatgtctgaacaccctttgcaagtcagttctgctgagatgtcaccaacgcaagaacatcctttggtgggcagttctggtgagatggtaccagcgcaagaacatcctttggtgggcagtttggctgagatggaaccaacacaagaacatcctttggtgggcaattcggctgagatggaaccaaagcctttggtgggcagttcggctgagatggcaccaacgcaagaacatacctttgtgggcagttcggctgagatggcaccaacgcaagaacatcctttggtgcgcagttcggccgagatggaaccaacacaagaacatcccatggtgggcagttcggccgagattacgtcgcagaaacctttggaaggtacttcgacccgaccaactagttttgagcaccctttggaatgcagctgattgatgttaccacctttggagtaacttacgttacccgtagaaaccgaaaccggctcggaattgtattatagatgggaaggtgttgtagcctgcatctgtaggcgactttgagggaggggtggtgttgcatgactgaacgttgcagttaatgtatccgcgggaacttccgtgtatataaaatatcagtaggagaactggtgggtgtacgagtcgctcagggtggacttcatctgttctttagttatttataggctaggctggaagaggtcaataaaatctcaggctttgatta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]