GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-30 03:27:11, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_044570587            2583 bp    mRNA    linear   PLN 25-OCT-2021
DEFINITION  PREDICTED: Triticum aestivum ubiquitin-like-specific protease 1D
            (LOC123150756), transcript variant X1, mRNA.
ACCESSION   XM_044570587
VERSION     XM_044570587.1
DBLINK      BioProject: PRJNA764258
KEYWORDS    RefSeq.
SOURCE      Triticum aestivum (bread wheat)
  ORGANISM  Triticum aestivum
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP
            clade; Pooideae; Triticodae; Triticeae; Triticinae; Triticum.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_057812.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Triticum aestivum Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2583
                     /organism="Triticum aestivum"
                     /mol_type="mRNA"
                     /cultivar="Chinese Spring"
                     /db_xref="taxon:4565"
                     /chromosome="7A"
                     /tissue_type="leaf"
                     /dev_stage="Vegetative"
                     /country="USA: Davis, California"
     gene            1..2583
                     /gene="LOC123150756"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 96 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:123150756"
     CDS             33..2291
                     /gene="LOC123150756"
                     /codon_start=1
                     /product="ubiquitin-like-specific protease 1D isoform X1"
                     /protein_id="XP_044426522.1"
                     /db_xref="GeneID:123150756"
                     /translation="
MPEAPAASPVDFSAASSFSSPTPTSPRPRPLGEPRRAAVNAMATASSEPLPSGEEGDEDAGARIDDDLRGMSDQALKERFKRLQDGLNKFPGVLPDGGKKYRRSLRAVRGELDRRTRLASDSASLRPRPRPPRPQGRLGEPDGNRGERMIQSSCAEPSGLSSKCNENHGVTKSDFLSAFEVDDEAGIDVEITSICPGKTKTPVENKGKSYEVSESCKTNAQPMPPKVLCIDNSIDVENMSSDDDFKDNDDIRIRENASTPSRKRKGDDSVNFSMRLRPRKAQEVVLLDADAHHSESAEKPTTKRDAMKIYYPSSEHSNSIELSHDDIKCLEPESLLSSTIMNFYIMYLQGPMSSISTQRGKYHIFNTYFFKKLEALKSKADKPSYFLNLRRWWKGIDIFQKPYILFPVHADTHWSLVIICMPAKEDQSGPIILHLDSLNFHNSRLIFSVVERFLKQEWNYLKENGSLAECPIRETVWKKLPRKIEKKPIAVPQQENEFDCGLFVLYYMQRFIEEAPERLHKKDLSMFGKTWFQPEEASALRKKMKTLLHQLFEEADPSNDSTSEQTACQSLLEVKPANNVMELATSEHPLEVSSAEVIPTSEHLLEVGSAEMTPMSEHPLQVSSAEMSPTQEHPLVGSSGEMVPAQEHPLVGSLAEMEPTQEHPLVGNSAEMEPKPLVGSSAEMAPTQEHTFVGSSAEMAPTQEHPLVRSSAEMEPTQEHPMVGSSAEITSQKPLEGTSTRPTSFEHPLECS"
     misc_feature    <810..1604
                     /gene="LOC123150756"
                     /note="Protease, Ulp1 family [Posttranslational
                     modification, protein turnover, chaperones]; Region: ULP1;
                     COG5160"
                     /db_xref="CDD:227489"
     polyA_site      2583
                     /gene="LOC123150756"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
cgtttctttttgcgagaaggccctcctccaatatgccagaggccccggctgccagccccgtcgacttctccgccgcctcctctttctcttccccaaccccaacttcccctcgaccccgccccctcggcgagccgcgccgcgccgcggtgaatgcgatggccacggcttcgtcggagccgctccccagcggcgaggagggggacgaggatgcgggggcgaggatcgatgacgaccttcgcggcatgtcggaccaggcgctgaaggagaggttcaaacgcctacaggacgggctcaacaaattccccggcgtcctcccggacggtgggaagaagtaccgccgctcgctccgcgccgtccgcggcgagctcgaccgccgcactcgcttggcctcggactcggcctctctccggccacggccgcggccaccgcgtccgcaaggccgcctaggcgagccggatggcaatagaggtgaacggatgatccagtcaagttgtgcagaaccgtctggtttgtctagtaaatgcaatgaaaatcatggagtaaccaaatctgatttcctttccgcatttgaggtggatgatgaggcaggcatcgatgtggagataacaagtatatgccctggcaagactaaaacgccagtagaaaataaagggaagtcgtatgaagtgagtgaatcttgcaaaaccaatgcacaaccaatgcctcccaaagtattatgtatcgacaactcaatcgacgtggaaaatatgtcttctgacgatgacttcaaggataacgacgatattaggatacgtgaaaatgcttccacaccttctcggaaaaggaaaggagatgactcagttaacttctcaatgcgattgagaccaagaaaggctcaagaggtggttctactcgatgcagatgcacaccattcagaatctgcagagaagccaaccactaaacgggatgcaatgaagatatattatccttcaagcgaacactcaaattctattgagctttctcatgatgacataaaatgccttgagcctgaatcgttactttcctcaactataatgaacttctacattatgtacctgcaaggaccaatgtcgtcgattagtacacaaagaggcaagtatcacattttcaatacatacttcttcaagaaacttgaagccctaaaatcaaaggcagacaagccttcttacttcttaaacctgagaagatggtggaaaggcatagatatatttcaaaagccatatatattatttcctgtgcatgcagatactcattggagcctggtgattatatgcatgccagcaaaggaagatcaatcaggccccattatacttcatttggattcactgaatttccataacagcagattgattttcagtgttgttgagagattcttaaaacaagaatggaattacctgaaggaaaatgggtctttagcagaatgtcctatacgagaaacagtgtggaagaaacttcctcgtaaaattgagaagaaaccaattgcggttccccagcaggaaaatgaatttgactgtggcctctttgttctgtactatatgcagcggttcatcgaggaggcacctgaaaggcttcacaagaaagacctttctatgtttggcaaaacatggtttcaacctgaagaggcttctgcattgcgaaagaaaatgaagaccctgcttcatcagttgtttgaggaagcggatcccagtaacgacagtacatcggagcagacagcgtgtcagtcgcttttggaagttaagcctgcaaacaacgtgatggagctggcaacgtcagaacaccctttggaagtcagttcagctgaggtgataccaacgtcggaacacctgctggaagtcggttctgctgagatgacaccaatgtctgaacaccctttgcaagtcagttctgctgagatgtcaccaacgcaagaacatcctttggtgggcagttctggtgagatggtaccagcgcaagaacatcctttggtgggcagtttggctgagatggaaccaacacaagaacatcctttggtgggcaattcggctgagatggaaccaaagcctttggtgggcagttcggctgagatggcaccaacgcaagaacatacctttgtgggcagttcggctgagatggcaccaacgcaagaacatcctttggtgcgcagttcggccgagatggaaccaacacaagaacatcccatggtgggcagttcggccgagattacgtcgcagaaacctttggaaggtacttcgacccgaccaactagttttgagcaccctttggaatgcagctgattgatgttaccacctttggagtaacttacgttacccgtagaaaccgaaaccggctcggaattgtattatagatgggaaggtgttgtagcctgcatctgtaggcgactttgagggaggggtggtgttgcatgactgaacgttgcagttaatgtatccgcgggaacttccgtgtatataaaatatcagtaggagaactggtgggtgtacgagtcgctcagggtggacttcatctgttctttagttatttataggctaggctggaagaggtcaataaaatctcaggctttgatta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]