2024-05-20 09:43:15, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_043739540 4284 bp mRNA linear INV 21-SEP-2021 DEFINITION PREDICTED: Bombus pyrosoma copper-transporting ATPase 1 (LOC122573337), transcript variant X11, mRNA. ACCESSION XM_043739540 VERSION XM_043739540.1 DBLINK BioProject: PRJNA759419 KEYWORDS RefSeq. SOURCE Bombus pyrosoma ORGANISM Bombus pyrosoma Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Aculeata; Apoidea; Anthophila; Apidae; Bombus; Melanobombus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_057781.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Bombus pyrosoma Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..4284 /organism="Bombus pyrosoma" /mol_type="mRNA" /isolate="SC7728" /isolation_source="wild" /db_xref="taxon:396416" /tissue_type="whole body" /country="China: Hebei" /collection_date="Aug-2016" /linkage_group="LG12" gene 1..4284 /gene="LOC122573337" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 7 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 8 samples with support for all annotated introns" /db_xref="GeneID:122573337" CDS 464..4177 /gene="LOC122573337" /codon_start=1 /product="copper-transporting ATPase 1 isoform X4" /protein_id="XP_043595475.1" /db_xref="GeneID:122573337" /translation="
MVCVSRPQKMKDSTNASTMKVNIEGMRCQSCVKNIEGTIGGRPEVLSVKVILEEKLGYIEYKAGEITPNELVEAIEDMGFTASLCSDETNSTEKIQKSDSLQLTIGTCTVHIDGMTCASCVKTITDGLSEKAGIKQANVSLEKKEATVSYNDKVLTAEQISGFVEEMGFNSFVKEVNGKVVGEETPMNLSLKNNSAQEELPLQMNGGGDVKTQNEIAKCFLHITGMTCASCVAAIEKHCKKLYGVNNILVALMAAKAEVAFDPNKIRAIDISSSISELGFPTTLIEELGTGEGDIELKITGMTCASCVNKIESTVRKLPGVHSAAVALATQRGKFKYDVEKIGVRDIIECINKLGFTAMLFINKDKENRDYLDQREEINKWRTAFLVSLIFGIPCMLAMTYFMVIMSVGEKTHEDMCCVVPGLSWENLILFIFSTPVQFFGGWHFYVQAYKALKHGTTNMDVLISMTTTISYLYSVAVLTAAMIMQEHVSPQTFFDTPPMLLVFISLGRWLEHVAKGKTSEALSKLLSLKATDAVLVTLGPNNELLSERLISIDLVQRGDVLKVVQGAKVPVDGRVLSGNSTCDESLITGESMPVPKKKGSVVIGGSINQNGPLLITATHTGEHTTLAQIVRLVEEAQTNKAPIQHLADKIAGYFIPLVIVVSIVTLLVWIIVGYVNVNSLPISHNDQINKHGMNREEIIFQYAFRSALCVLAIACPCALGLATPTAVMVGTGVGALNGILIKGAEPLENAHKVKCIVFDKTGTITHGIPMVTKINLFVNETAYSLAKFLVIICTAETNSEHPIASAIVRYVKETIGSEATGQCMNFQAVAGCGLKCKVSHISTTLADALKSDKILNYTNEVKRLPSGTHNLNNVSIDVTPISSTRQNLELLLSPDSHGDQTSPDDVYEICVGNREWMRRNAINIPQEVELKMVTEEDLGHTAVLAAVNNVLVAMISVADTVKPEAHLAIYTLKKMGLEVILLTGDNRKTAVSIARQVGITRVFAEVLPSHKVAKIQRLQDQGLRVAMVGDGVNDSPALAQSDVGIAISSGTDVAVEAADVVLMRNDLLDVIACLDLSRKTVRRIRLNFLFASIYNLLGIPIAAGIFSSFGFFLQPWMSSAAMALSSASVVGSSLLLKLYRKPTKTTLETPEYLSAMHAHSTARMIDLDTISLHRGLDDTVIPIMHRSTSTLSRLFRRSKDDVEGRLLGEDIDEIDLVTDFSGYRKNIKDHTNITPL"
misc_feature 521..712 /gene="LOC122573337" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(539..547,554..556) /gene="LOC122573337" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 797..970 /gene="LOC122573337" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(806..814,821..823) /gene="LOC122573337" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1124..1318 /gene="LOC122573337" /note="copper chaperone CopZ; Region: chaper_CopZ_Eh; NF033794" /db_xref="CDD:411374" misc_feature 1349..1537 /gene="LOC122573337" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1367..1375,1382..1384) /gene="LOC122573337" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1616..3877 /gene="LOC122573337" /note="P-type heavy metal-transporting ATPase, similar to human copper-transporting ATPases, ATP7A and ATP7B; Region: P-type_ATPase_Cu-like; cd02094" /db_xref="CDD:319783" misc_feature order(2609..2611,2615..2617,3746..3748) /gene="LOC122573337" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" misc_feature order(2741..2749,2951..2953,3197..3205,3293..3295, 3413..3421,3479..3481,3488..3490,3497..3499,3554..3556, 3563..3565) /gene="LOC122573337" /note="putative ATP binding site [chemical binding]; other site" /db_xref="CDD:319783" misc_feature 2741..2761 /gene="LOC122573337" /note="P-type ATPase signature motif; other site" /db_xref="CDD:319783" misc_feature 2741..2743 /gene="LOC122573337" /note="phosphorylation site [posttranslational modification]" /db_xref="CDD:319783" misc_feature order(3749..3751,3830..3832,3842..3844) /gene="LOC122573337" /note="putative Cu binding site [ion binding]; other site" /db_xref="CDD:319783" polyA_site 4284 /gene="LOC122573337" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
cagtcgtatcgcgagagatgctgactcgagcgcattattttcctgtacaattttcacattaaccgacaaacgtgcaagttacataaaacagaaagtatttcctcttaagataagagagagtaacgtagcttatttacgtttcgggtcactgtaaacgataatatcgcgtttttaataagactaattttgctaattgctcgttaaaaattcgaatcgatgacgagaagatggtgctgctcatcgttttgatcattgacgttcaatttggaggaaaatcactgtaattggaaagaaatatgttcgctcgatcgtattctaacgtttaaacgaataactcgcttcgaagatcgaccgatgacaattactttcttttatcgtttataaaacgaacgatagccaagctgcttcggttgcataatgcagcgatggggaggacgataccgattacgaaggcacgacaccgatggtgtgcgtttctcggccgcagaaaatgaaagattccacgaatgcttccactatgaaggttaatatcgagggtatgagatgtcagagctgtgtgaagaacatcgagggaaccataggtggccggccggaggttttaagcgttaaagtaatcctagaggagaagctcggttacatcgaatataaagcgggagaaattacgccgaacgaattggtcgaggcgatagaggatatgggattcaccgcttccctttgcagcgacgaaactaactctactgaaaagatacaaaaaagtgattcgttgcaattaactatcggtacttgtactgtacatatcgatggaatgacttgtgcgtcttgcgttaaaactatcaccgatggtttatcggagaaagcaggaataaagcaggcgaacgttagtttagagaagaaggaagctacggtttcttataacgataaagtcctaacggctgaacaaatatcagggttcgtcgaggaaatgggttttaattcgtttgttaaagaagtaaacggtaaagttgtaggagaggaaacaccaatgaatttatcgttaaaaaacaattctgcgcaagaggaacttccgttgcaaatgaatgggggaggtgatgtaaagactcaaaacgaaatagcaaaatgctttttacatataacggggatgacctgtgcttcctgcgttgctgccatagaaaaacattgcaaaaaattatacggtgtaaataatatcttggtcgcattgatggcggccaaggcagaagttgcctttgatccgaataagataagggcgatcgacatttcttctagcatatcggaattgggcttccctactactttgatcgaggaacttggcactggagagggagacattgaattaaaaatcacaggtatgacatgtgcatcttgcgtgaataagatagaatcgactgtgaggaaattgccaggcgtccattctgccgctgtcgcgttggcaactcaacgtggcaaattcaaatacgatgtggaaaaaattggcgtcagggacattatcgaatgcattaacaaattaggtttcaccgcaatgttatttatcaataaagataaagaaaacagagactacttggatcagagggaagaaataaacaagtggcggacagcgttcttagtgtccttaatttttggcataccgtgtatgttagccatgacgtactttatggtaatcatgtctgttggtgaaaaaacgcacgaagatatgtgttgcgtagttcctggtctttcctgggaaaacttaatccttttcatattttctacaccagtccagttttttggcggctggcatttttacgttcaagcgtacaaagctttgaaacacggtacaactaatatggatgttttaatttctatgacgactacgatatcttatttgtactcagttgccgtacttacagcagccatgataatgcaggaacacgttagtcctcagacattttttgacactcctccgatgttgttagtgttcatcagtttaggaagatggttagaacacgtcgcaaagggtaaaacctcggaggcgttatcgaaattattgtctttgaaagcaacggacgcggtcctggttactttgggccctaataatgaactactatctgagcgtttaatcagtatagatttagtacaacgaggcgatgtcctaaaagtagtgcaaggtgccaaagttcccgtcgatggtagagttttatcaggcaattctacttgcgacgagagcctaattaccggggaaagtatgccggtgccaaaaaagaagggatcggttgtaataggtggctcgataaatcaaaatggtccgcttctaattactgccacgcatacaggagaacacacgacattggcacaaattgtacgattagtagaagaggcacaaacgaataaggcacctatccaacatttagccgataagatagctggttatttcatacctcttgttatagttgtttctatagtaactttactcgtttggataatagtgggatatgtaaatgtaaacagtttaccaatctcgcacaacgaccaaatcaataaacacggaatgaatagagaagaaattatatttcaatatgcttttcgaagcgcgctttgcgtattagcaatagcttgtccatgcgctttaggattggctacgccaactgctgttatggttggtactggagtcggagcattaaatggtatcttaataaaaggtgctgaacctttggaaaatgcgcacaaagttaaatgtattgtattcgataagaccggaacaataacacatggtataccaatggtaacaaagataaatctctttgtaaatgaaacagcttattcactagcaaagttcttggtcattatctgtacagctgaaacaaatagcgaacatccgatcgcatcagcaattgtgcgatacgtgaaggaaacgataggctccgaagcaactggacagtgcatgaattttcaagcagttgctggttgcggacttaaatgtaaagtatcacacatttcaactacgttggccgatgcattaaaatctgataagattcttaactatactaacgaggtaaaaagattaccttctggaacgcataatttaaataatgtgtcgatcgatgttacgccaatttcgagcacgagacaaaatttggaattgttgctaagtccggattcccatggtgaccagactagtcctgacgatgtatatgaaatttgcgttggtaacagggagtggatgcgaagaaatgctattaatataccacaagaagtagagttgaaaatggttaccgaagaagatctgggacatactgctgttttagcagcagtgaataatgtactggtggctatgatcagtgtagcagatacggttaaaccagaagcccatctggcaatctatactttgaaaaaaatgggtttggaagtcattcttttaacaggagataatagaaagactgctgtttctattgctagacaagttggtattactagagtatttgcagaagtgttaccttcgcacaaagttgctaaaattcagcgtttacaagatcaaggcctaagagttgcaatggtaggagatggtgttaatgatagtcctgcccttgcacaatcagacgttggcattgcaatatcttctggtacggatgttgctgtggaagctgccgatgtagtcctcatgcgaaacgatcttctagatgttattgcgtgtctggatctatcgagaaaaacagttcgtcgaataagattgaattttttatttgccagtatctataatttgttgggtattcctattgctgctggaatatttagctctttcgggttttttcttcaaccttggatgtcgtcagcggcgatggcattaagctcagcatctgtagttggtagttctttgttactaaaattgtatcgtaaaccaacgaagaccactttagaaacaccagaatatttatcagcgatgcatgctcattctactgcaagaatgattgatctagatacaatatctcttcatcgtggtttagatgatactgtaatacctattatgcatagatcaacatcgacattgtccaggctatttaggagatctaaggacgatgtagagggtcgcctcctaggtgaagatattgatgaaattgatttggtaacagatttttctggatatcgaaaaaatataaaggaccatacaaacataacacccttatgacttgtaaggatcttctttatataattcttattctgtgcatgtgtgtgtgtgtgcgcgcgcacggacatttttttgccaataatataataaactgacatttaatcaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]