GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-09-18 10:07:52, GGRNA.v2 : RefSeq release 231 (Jul, 2025)

LOCUS       XM_042772380            2002 bp    mRNA    linear   VRT 27-JUL-2021
DEFINITION  PREDICTED: Cyprinus carpio uncharacterized LOC109089169
            (LOC109089169), transcript variant X1, mRNA.
ACCESSION   XM_042772380
VERSION     XM_042772380.1
DBLINK      BioProject: PRJNA745992
KEYWORDS    RefSeq.
SOURCE      Cyprinus carpio (common carp)
  ORGANISM  Cyprinus carpio
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Cyprinidae; Cyprininae; Cyprinus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_056587.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cyprinus carpio Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2002
                     /organism="Cyprinus carpio"
                     /mol_type="mRNA"
                     /isolate="SPL01"
                     /db_xref="taxon:7962"
                     /chromosome="A16"
                     /tissue_type="muscle"
                     /dev_stage="adult"
     gene            1..2002
                     /gene="LOC109089169"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 3 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:109089169"
     CDS             89..1891
                     /gene="LOC109089169"
                     /codon_start=1
                     /product="uncharacterized protein LOC109089169 isoform X1"
                     /protein_id="XP_042628314.1"
                     /db_xref="GeneID:109089169"
                     /translation="
MMKSFQLSYFQLLCLLTAALLECKAETERPCKQVYQLNIRHLHGDSMSISCQTTPHPLESLTVKLRSIIPLKDILNYPDTSSASEHQRWSVRNDAGNVTFDLKDIRSSDGGLYDCQVYKDQDCLHSTRFNLSVIMCETLNSVHATLNSSVLLPCSEHPLQNRTEQVTWKVVSGHQLTDVNQYRAPYKPSSSTEKPPDPLYERARQLKNGSLLIRNAVHTDELWYRCRVNGKTCYEIKLVMKAETERPCKQVYQLNISHLHGDSMSISCQTTTHPLESLTVKLRSIIPLKDILNYPDTSSASEHQRWSVRNDAGNVIFDLKDIRSSDGGFYDCQVYKDQDCLHTTRFNLSIIMCKTLNSVHATLNSSVLLPCSEHPLHNRTEQVTWKVVSGHQSTDINQYRAPYKPSSSTEKPPDPLYERARQLKNGSLLVRNAGHTDELLYRCRVNEKTCYEIKLVIKDDKTFYSTILETLSTTLLSTTDAPTPAADNTAGQTEGNNHEESETVTANLTVVVMTTVVSLCVLISLTICVILYFKKRRRKTNSQIQLNSQFSVYYSRVAEGFDVPLYSLVEQNTGTMITFGAEQSEAPAYKPDDMYEKLTF"
     misc_feature    218..487
                     /gene="LOC109089169"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:214653"
     misc_feature    509..772
                     /gene="LOC109089169"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    536..550
                     /gene="LOC109089169"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    581..595
                     /gene="LOC109089169"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    713..727
                     /gene="LOC109089169"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    755..772
                     /gene="LOC109089169"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     polyA_site      2002
                     /gene="LOC109089169"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
tggagtacctgaaaacaactctgtgaaagtgaagtcatgtggcctgtgctcatatagagtccagctgtcctgcagtgagcatctgtatatgatgaagagttttcagctttcttatttccagctcctgtgtcttctaacagcagcgttattagaatgtaaagctgaaacagagagaccctgcaagcaggtttatcagttgaacataaggcatttacacggtgacagcatgtctatttcttgccaaacaacaccccacccgctggagtctctaacagtcaaactacgcagtatcatcccgcttaaagacatcctgaattatccagacacctcttcagcatcagagcaccagagatggtctgtgaggaatgatgctggaaatgttacatttgatctgaaagacatcagatcatccgatggtggcctttatgactgtcaggtctacaaggatcaggactgccttcattcaactcgatttaacctgagtgttataatgtgtgaaactttgaactctgtccatgcaacgctaaactcgtcagtgttgctgccgtgctctgaacatcctctacaaaacagaactgaacaagtcacttggaaagttgttagtggtcatcaattaacggatgtaaaccagtatcgagctccatacaagccctccagcagcacagagaaaccaccggaccccctgtatgagagagcgagacaactaaagaacggatctttgcttataaggaatgcagtacacactgatgaattgtggtatcggtgcagagtgaatggaaaaacctgctatgagattaagctggtgatgaaagctgaaacagagagaccctgcaagcaggtttatcagttgaacataagccatttacacggtgacagcatgtctatttcttgccaaacaacaacgcacccactggagtctctaacagtcaaactacgcagtatcatcccgcttaaagacatcctgaattatccagacacctcttcagcatcagagcaccagagatggtctgtgaggaatgatgctggaaatgttatatttgatctgaaagacatcagatcatccgatggtggtttttatgactgtcaggtctacaaggatcaggactgccttcatacaactcgatttaacctgagtattataatgtgtaaaactttgaactctgtccatgcaacgctaaactcgtcagtgttgctgccgtgctctgaacatcctctacacaacagaactgaacaagtcacttggaaagttgttagtggtcatcaatcaacagatataaaccagtatcgagctccatacaagccctccagcagcacagagaaaccaccggaccccctgtatgagagagcgagacaactaaagaacggatctttgcttgtaaggaatgcaggacacactgatgaattgttgtatcggtgcagagtgaatgaaaaaacctgctatgagattaagctggtgataaaagatgataaaacattttattcaacaattctggaaacactttccacaacattgttatccaccacagatgctccaaccccagctgctgacaatacggctggccaaactgaaggcaacaaccatgaagagagtgaaacagtgacagctaatctgacagtagtagtgatgaccacagtagtgtctctgtgtgtcctcatatcactgaccatttgtgtcattctttatttcaaaaaacgaagacgcaaaaccaacagccaaatacagttaaacagtcagttctctgtatattactcccgtgttgcagaagggtttgatgtcccgttgtattctttagttgaacaaaacacaggaacaatgatcacctttggtgctgaacaatcagaagctccggcatataaaccagatgacatgtatgaaaagttaacattttgaaatgaataatggcctttttaatgtttttagacatcagagtcttttagtaatcactgattatatggcatttgtcacaaattataataaagggtaacatcttttattcacaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]