2025-09-18 10:07:52, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XM_042772380 2002 bp mRNA linear VRT 27-JUL-2021 DEFINITION PREDICTED: Cyprinus carpio uncharacterized LOC109089169 (LOC109089169), transcript variant X1, mRNA. ACCESSION XM_042772380 VERSION XM_042772380.1 DBLINK BioProject: PRJNA745992 KEYWORDS RefSeq. SOURCE Cyprinus carpio (common carp) ORGANISM Cyprinus carpio Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Cyprininae; Cyprinus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_056587.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cyprinus carpio Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2002 /organism="Cyprinus carpio" /mol_type="mRNA" /isolate="SPL01" /db_xref="taxon:7962" /chromosome="A16" /tissue_type="muscle" /dev_stage="adult" gene 1..2002 /gene="LOC109089169" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 3 samples with support for all annotated introns" /db_xref="GeneID:109089169" CDS 89..1891 /gene="LOC109089169" /codon_start=1 /product="uncharacterized protein LOC109089169 isoform X1" /protein_id="XP_042628314.1" /db_xref="GeneID:109089169" /translation="
MMKSFQLSYFQLLCLLTAALLECKAETERPCKQVYQLNIRHLHGDSMSISCQTTPHPLESLTVKLRSIIPLKDILNYPDTSSASEHQRWSVRNDAGNVTFDLKDIRSSDGGLYDCQVYKDQDCLHSTRFNLSVIMCETLNSVHATLNSSVLLPCSEHPLQNRTEQVTWKVVSGHQLTDVNQYRAPYKPSSSTEKPPDPLYERARQLKNGSLLIRNAVHTDELWYRCRVNGKTCYEIKLVMKAETERPCKQVYQLNISHLHGDSMSISCQTTTHPLESLTVKLRSIIPLKDILNYPDTSSASEHQRWSVRNDAGNVIFDLKDIRSSDGGFYDCQVYKDQDCLHTTRFNLSIIMCKTLNSVHATLNSSVLLPCSEHPLHNRTEQVTWKVVSGHQSTDINQYRAPYKPSSSTEKPPDPLYERARQLKNGSLLVRNAGHTDELLYRCRVNEKTCYEIKLVIKDDKTFYSTILETLSTTLLSTTDAPTPAADNTAGQTEGNNHEESETVTANLTVVVMTTVVSLCVLISLTICVILYFKKRRRKTNSQIQLNSQFSVYYSRVAEGFDVPLYSLVEQNTGTMITFGAEQSEAPAYKPDDMYEKLTF"
misc_feature 218..487 /gene="LOC109089169" /note="Immunoglobulin like; Region: IG_like; smart00410" /db_xref="CDD:214653" misc_feature 509..772 /gene="LOC109089169" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:472250" misc_feature 536..550 /gene="LOC109089169" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 581..595 /gene="LOC109089169" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 713..727 /gene="LOC109089169" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 755..772 /gene="LOC109089169" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" polyA_site 2002 /gene="LOC109089169" /experiment="COORDINATES: polyA evidence [ECO:0006239]" ORIGIN
tggagtacctgaaaacaactctgtgaaagtgaagtcatgtggcctgtgctcatatagagtccagctgtcctgcagtgagcatctgtatatgatgaagagttttcagctttcttatttccagctcctgtgtcttctaacagcagcgttattagaatgtaaagctgaaacagagagaccctgcaagcaggtttatcagttgaacataaggcatttacacggtgacagcatgtctatttcttgccaaacaacaccccacccgctggagtctctaacagtcaaactacgcagtatcatcccgcttaaagacatcctgaattatccagacacctcttcagcatcagagcaccagagatggtctgtgaggaatgatgctggaaatgttacatttgatctgaaagacatcagatcatccgatggtggcctttatgactgtcaggtctacaaggatcaggactgccttcattcaactcgatttaacctgagtgttataatgtgtgaaactttgaactctgtccatgcaacgctaaactcgtcagtgttgctgccgtgctctgaacatcctctacaaaacagaactgaacaagtcacttggaaagttgttagtggtcatcaattaacggatgtaaaccagtatcgagctccatacaagccctccagcagcacagagaaaccaccggaccccctgtatgagagagcgagacaactaaagaacggatctttgcttataaggaatgcagtacacactgatgaattgtggtatcggtgcagagtgaatggaaaaacctgctatgagattaagctggtgatgaaagctgaaacagagagaccctgcaagcaggtttatcagttgaacataagccatttacacggtgacagcatgtctatttcttgccaaacaacaacgcacccactggagtctctaacagtcaaactacgcagtatcatcccgcttaaagacatcctgaattatccagacacctcttcagcatcagagcaccagagatggtctgtgaggaatgatgctggaaatgttatatttgatctgaaagacatcagatcatccgatggtggtttttatgactgtcaggtctacaaggatcaggactgccttcatacaactcgatttaacctgagtattataatgtgtaaaactttgaactctgtccatgcaacgctaaactcgtcagtgttgctgccgtgctctgaacatcctctacacaacagaactgaacaagtcacttggaaagttgttagtggtcatcaatcaacagatataaaccagtatcgagctccatacaagccctccagcagcacagagaaaccaccggaccccctgtatgagagagcgagacaactaaagaacggatctttgcttgtaaggaatgcaggacacactgatgaattgttgtatcggtgcagagtgaatgaaaaaacctgctatgagattaagctggtgataaaagatgataaaacattttattcaacaattctggaaacactttccacaacattgttatccaccacagatgctccaaccccagctgctgacaatacggctggccaaactgaaggcaacaaccatgaagagagtgaaacagtgacagctaatctgacagtagtagtgatgaccacagtagtgtctctgtgtgtcctcatatcactgaccatttgtgtcattctttatttcaaaaaacgaagacgcaaaaccaacagccaaatacagttaaacagtcagttctctgtatattactcccgtgttgcagaagggtttgatgtcccgttgtattctttagttgaacaaaacacaggaacaatgatcacctttggtgctgaacaatcagaagctccggcatataaaccagatgacatgtatgaaaagttaacattttgaaatgaataatggcctttttaatgtttttagacatcagagtcttttagtaatcactgattatatggcatttgtcacaaattataataaagggtaacatcttttattcacaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]