GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-20 07:37:13, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_042515092             481 bp    mRNA    linear   VRT 19-JUL-2021
DEFINITION  PREDICTED: Plectropomus leopardus sodium/potassium-transporting
            ATPase subunit alpha-1-like (LOC121964914), partial mRNA.
ACCESSION   XM_042515092
VERSION     XM_042515092.1
DBLINK      BioProject: PRJNA744194
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Plectropomus leopardus (leopard coralgrouper)
  ORGANISM  Plectropomus leopardus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Perciformes; Serranoidei; Serranidae;
            Epinephelinae; Epinephelini; Plectropomus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024619089.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Plectropomus leopardus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 9.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 1% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..481
                     /organism="Plectropomus leopardus"
                     /mol_type="mRNA"
                     /isolate="mb"
                     /db_xref="taxon:160734"
                     /chromosome="Unknown"
                     /tissue_type="muscle"
     gene            <1..>481
                     /gene="LOC121964914"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 13 Proteins, and 99% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 3 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:121964914"
     CDS             <1..>481
                     /gene="LOC121964914"
                     /codon_start=1
                     /product="sodium/potassium-transporting ATPase subunit
                     alpha-1-like"
                     /protein_id="XP_042371026.1"
                     /db_xref="GeneID:121964914"
                     /translation="
ACVVHGGDLKDLTAEQLDDILKYHTEIVFARTSPQQKLIIVEGCQRQGAIVAVTGDGVNDSPALKKADIGVAMGIAGSDVSKQAADMILLDDNFASIVTGVEEGRLIFDNLKKSIAYTLTSNIPEITPFLLFIIANIPLPLGTVTILCIDLGTDMVKMHK"
     misc_feature    <1..>468
                     /gene="LOC121964914"
                     /note="sodium or proton efflux -- potassium uptake
                     antiporter, P-type ATPase, alpha subunit; Region:
                     ATPase-IIC_X-K; TIGR01106"
                     /db_xref="CDD:273445"
ORIGIN      
gcctgcgtagtccacggtggagacctgaaagatctgactgcggagcagcttgacgacatcctgaagtaccacactgagattgttttcgccagaacctccccgcagcagaaactgatcattgtggagggctgccagagacagggagccattgtggctgtgacaggtgacggtgtgaacgactctcccgctctgaagaaggctgacatcggtgtcgccatgggtatcgctggatctgacgtctcaaagcaggccgccgacatgatcctgctggacgacaactttgcctccatcgttactggagtagaagaaggccgtctgatctttgacaacttgaagaagtccatcgcctacacgctgactagcaacatccctgagatcacccccttcctcctcttcatcatcgccaacatccctctgcccctgggaaccgtcaccatcctctgtattgatctgggaactgacatggtaaagatgcacaaat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]