2024-04-19 03:04:19, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_042482074 3108 bp mRNA linear VRT 19-JUL-2021 DEFINITION PREDICTED: Plectropomus leopardus GTP binding protein 3, mitochondrial (gtpbp3), transcript variant X1, mRNA. ACCESSION XM_042482074 VERSION XM_042482074.1 DBLINK BioProject: PRJNA744194 KEYWORDS RefSeq. SOURCE Plectropomus leopardus (leopard coralgrouper) ORGANISM Plectropomus leopardus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Perciformes; Serranoidei; Serranidae; Epinephelinae; Epinephelini; Plectropomus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_056465.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Plectropomus leopardus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3108 /organism="Plectropomus leopardus" /mol_type="mRNA" /isolate="mb" /db_xref="taxon:160734" /chromosome="3" /tissue_type="muscle" gene 1..3108 /gene="gtpbp3" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 10 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:121938921" CDS 250..1797 /gene="gtpbp3" /codon_start=1 /product="tRNA modification GTPase GTPBP3, mitochondrial isoform X1" /protein_id="XP_042338008.1" /db_xref="GeneID:121938921" /translation="
MMLSSIYRGIWRAAVHTLTTSRGTPYRFLSTSDRLPLADAESIFALSSGHGRCGVAVVRASGPASATALKCMTGLTHSLPPPRTAMLRNITDPQTKEVLDRGLVLWFPAPHSFTGEDSVEFHIHGGPAVITGVLQALGSVPGMRPADAGEFTRRAFQAGKLGLTEVEGLGDLIHAETEAQRRQALRQMSGELGRLYQDWSHRLKRCLAHVEAFIDFSEDELIEDGVLNQVDRSVCDLQTQIECHLKDERRGERLRSGVLVVIAGATNAGKSSLLNTLCQRPAAIVSPIAGTTRDVVEMALDIGGFPVLLSDTAGLRESPDLVEREGVRRARERVEQADLTLVVVDSSHLPSDAQKAAAFLQEYLGSVLPTVEQPETVFPADRFLLVLNKTDLLPQEQKLKLDRQLRQVSGLPPVCFISCHTNEGLQDFLAVLHSSVKTLCGDPLSGAPSLTQARHRAHLQQCVSALAQYQRYRDIDLALAAEGVRLALTSLGRITGRVGAEEILDIIFKDFCIGK"
misc_feature 376..1794 /gene="gtpbp3" /note="tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE; Region: trmE; PRK05291" /db_xref="CDD:235392" misc_feature 1039..1062 /gene="gtpbp3" /note="G1 box; other site" /db_xref="CDD:206727" misc_feature order(1048..1050,1054..1065,1411..1416,1420..1422, 1501..1509) /gene="gtpbp3" /note="GTP/Mg2+ binding site [chemical binding]; other site" /db_xref="CDD:206727" misc_feature 1084..1134 /gene="gtpbp3" /note="Switch I region; other site" /db_xref="CDD:206727" misc_feature 1123..1125 /gene="gtpbp3" /note="G2 box; other site" /db_xref="CDD:206727" misc_feature order(1177..1209,1213..1257) /gene="gtpbp3" /note="Switch II region; other site" /db_xref="CDD:206727" misc_feature 1180..1191 /gene="gtpbp3" /note="G3 box; other site" /db_xref="CDD:206727" misc_feature 1411..1422 /gene="gtpbp3" /note="G4 box; other site" /db_xref="CDD:206727" misc_feature 1501..1509 /gene="gtpbp3" /note="G5 box; other site" /db_xref="CDD:206727" ORIGIN
cttgaaagtcgccggtgctggagcttgttacttaatgaagctttcacagaataatatagtaagcctaaacttgatgaattatcagcattatcagctaacgttacatttcaggttacttccggacattagcttaaagtgaaaaaggtaaaaataatgattttgtcaaggacacatcctgtttcagtgtcagtctgtgaaatcagacacaccagaaacagcacatgaaacgtttggtgttagtatattttaatgatgctgtcatccatttatcgtgggatatggagagctgctgtccacacgcttacgacaagcagaggaacaccttacagattcctctccacttctgatagactcccactggctgatgctgagtccatctttgcattatcatcaggtcatggcaggtgtggggtcgctgtggtacgagccagtggtccagcttcagctacagctctgaagtgtatgactggtctcacacacagtctgccgcctccacgcaccgccatgttacgcaacatcacagacccccaaaccaaagaagtgctggaccgtggacttgttctgtggttcccagctcctcacagtttcaccggagaggacagtgtggagttccatatccacggaggtcctgctgtcattactggtgtcttacaggctctaggaagcgtgcctggcatgaggcctgctgatgctggagagttcacgcggagggcctttcaagcagggaagctgggtttaacagaggtggaggggcttggggatctgatccatgctgagacagaggcccagaggagacaggctctcaggcagatgtcaggagagctgggacggctttatcaggactggagccacagactgaaacggtgtctggctcatgttgaggccttcatagacttcagtgaggatgagctcattgaggatggggtcttaaaccaagtggacaggtcggtgtgtgatctgcaaacacaaattgagtgccacctaaaggatgagaggcggggtgagcggctacgcagcggagtcctggtggttatcgcaggggccaccaatgcagggaaaagtagcctcctcaacacactctgccaaagacctgcagccattgtgtcccccattgctggcaccaccagggacgtagtagagatggcacttgacatcggtgggtttcctgtcctcttgagtgacacagccggcctcagagagagccccgacctggtggagagagagggggtacgccgagctcgagaaagagtggaacaggcagatctgaccctggtggttgtggactcttctcatctcccctctgatgcacagaaagctgcagccttccttcaggagtacctcgggagtgtcctgcccactgtggagcagccagagacagtgtttcctgcagacagatttctcctagtgctgaataaaactgacctgttgcctcaggagcagaagctgaagctggacaggcagctgagacaggtctcaggactccctcctgtttgtttcatctcttgccacactaatgaaggactgcaggacttcctagcagtccttcacagcagtgtcaagactctgtgtggagaccctttgtctggtgcccctagcctgacccaggctcgccacagggcccacctgcagcagtgtgtttcggccctggctcagtaccagcggtaccgcgacatcgacctcgctctggcagccgagggtgttcgtttggctctcaccagcttgggccggatcactggacgtgttggggcagaggagatcctggatatcatcttcaaagacttttgcattggaaagtagtcagatgagtaaaaacatgaaatacatgtaatatcagtctgctcagagcggaagtctgcattcttgtttggtcccagagtatcagttaagaaaacaagaaaaaaagggcaacgcctcggcataatgccaggcttcgaggcgcagcaagagtaaaaagaagaaaattcatgttcttggctgcaggatcactctgctcccaagacacattaatctttgttttccatagatgctctttgagagcctgaaatatttttaacgtgatgacaggtgcctcaaaagccccgtttgctagacaagtgtttggcaagtcttgagtcgtaatttaaaaatagcttctgaaagcctttgataggtgaacattgggctcttgggtcccaacataacagccaagatcatttaaaatacagccagctgcagacctctgcaaggtcatggacccatagtttggatgtttacttgtactgcaggacaatgaataattttcctttttgggagcagatatttcagctgcacccctcggtgtttgtctgaatgctagaatgcttcacgaatcagttaagatgcagttacagttaaatctatgtctgttgagactcatgtgatgttttgtttttctaagtgtttttgcagaacattaagatgtcacagtaaagcttacctttgaacttttggatataaaatgtcttcacattatattcctttagacatttgtgtgaaattgagttatggccaaaaacatttttagtcaggtcagagtgaccttgatcttgtgcatcaaaatctaatcagtcttttgttgtgtccaagtgggcaattgtgccaaatttgaagaaattccctcacagttttcttgagatatcacattcatgcatatgagatggaggtcacagtgaccttgacctttgacctttaacacctaaaaactaatcagttcattgtcaagtccaacattgagttgaactcgacaatgactagctttgattccagccctgagacattttttacatgtcaaaccccgctctttctctgtccccaatttctgcaccatactctgtcaaattaaggaaaaagtgccacaaacaattattttttaaaaccaaaaaaagtgttatttgcctatttacacacccatccgacagggaacaatattaccattatgtttctgtttattgtgttcttacatgttattacatatttgaaggtgcatcaggttgttactgtaattaaaaagaatgtaaggctttaaaaaagcagggtgtttacaagaccttaaaaagttttaaaatgtattcgattcagacttagacttag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]