LOCUS       XM_041523461             876 bp    mRNA    linear   INV 09-MAY-2021
DEFINITION  PREDICTED: Gigantopelta aegis transcription factor SPT20 homolog
            (LOC121392078), partial mRNA.
ACCESSION   XM_041523461
VERSION     XM_041523461.1
DBLINK      BioProject: PRJNA727593
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Gigantopelta aegis
  ORGANISM  Gigantopelta aegis
            Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda;
            Neomphalina; Neomphaloidea; Peltospiridae; Gigantopelta.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024533299.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Gigantopelta aegis Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
            COMPLETENESS: incomplete on the 3' end.
FEATURES             Location/Qualifiers
     source          1..876
                     /organism="Gigantopelta aegis"
                     /mol_type="mRNA"
                     /isolate="Gae_Host"
                     /isolation_source="hydrothermal vent"
                     /db_xref="taxon:1735272"
                     /chromosome="Unknown"
                     /tissue_type="foot"
                     /country="Indian Ocean"
                     /collection_date="2019-04"
     gene            1..>876
                     /gene="LOC121392078"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein"
                     /db_xref="GeneID:121392078"
     CDS             1..>876
                     /gene="LOC121392078"
                     /codon_start=1
                     /product="transcription factor SPT20 homolog"
                     /protein_id="XP_041379395.1"
                     /db_xref="GeneID:121392078"
                     /translation="

MNSYKRVATNNFSQQRGSRRRAFPVARRLSTATRICFQKDSPTGNNRNCNKMNILNDEDLREALYKEDHKQQQKSFPLARTPTANRRAFPVARKHTKKQQEELFSCKKTTNSNKKSFPSCKTTHQQQQEELSQLQEDYQQQQEELFQLQEGHQQQQEELLAKKTVARRLFPVAKRQQEPREFPSCKKTTNSNKKSFPSCKKTTNSNKKNLLISNKALQQEIEQQEISILNYQRFMSSKKKTSPITGRHQQQLLDYQQQNVILEQIQKELDELSKKKWKSLQRKITSIKTSWK"

ORIGIN      

atgaattcctacaagagagtcgcaaccaacaacttttcccagcaaagaggatcaagaagaagggctttcccagttgcaagaaggctatcaacagcaacgagaatttgtttccaaaaggactcaccaacaggaaataatagaaactgcaacaaaatgaatattctcaacgacgaagatttacgagaggctttatacaaggaagaccacaaacagcaacagaagagctttccacttgcaagaaccccaacagcaaacagaagagctttcccagttgcaagaaaacacaccaaaaagcaacaagaagagcttttcagttgcaagaagactaccaacagcaacaagaagagctttcccagttgcaagacgacccaccaacagcaacaagaagagctttcccagttgcaagaagactaccaacagcaacaagaagagcttttccagttgcaagaaggacaccaacagcaacaagaagagcttttggcaaagaagacagttgcaagaagacttttcccagttgcaaaaagacaacaagaaccaagagagttccccagttgcaagaagactaccaacagcaacaagaagagctttcccagttgcaagaagactaccaacagcaacaagaagaatcttctcatatccaacaaggctctccaacaggaaatagaacagcaagaaattagtattctaaactaccagagatttatgagcagcaagaaaaagacctctccaattacaggaagacaccaacaacagttactagattatcaacaacaaaatgtgatattagagcaaattcaaaaagaacttgacgaactaagcaagaagaaatggaagtccctacaaagaaagattacttctataaaaacaagctggaaa

//