2024-04-26 06:38:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_041496673 1963 bp mRNA linear INV 09-MAY-2021 DEFINITION PREDICTED: Gigantopelta aegis uncharacterized LOC121371050 (LOC121371050), mRNA. ACCESSION XM_041496673 VERSION XM_041496673.1 DBLINK BioProject: PRJNA727593 KEYWORDS RefSeq. SOURCE Gigantopelta aegis ORGANISM Gigantopelta aegis Eukaryota; Metazoa; Spiralia; Lophotrochozoa; Mollusca; Gastropoda; Neomphalina; Neomphaloidea; Peltospiridae; Gigantopelta. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_054699.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Gigantopelta aegis Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1963 /organism="Gigantopelta aegis" /mol_type="mRNA" /isolate="Gae_Host" /isolation_source="hydrothermal vent" /db_xref="taxon:1735272" /chromosome="1" /tissue_type="foot" /country="Indian Ocean" /collection_date="2019-04" gene 1..1963 /gene="LOC121371050" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 4 samples with support for all annotated introns" /db_xref="GeneID:121371050" CDS 46..1320 /gene="LOC121371050" /codon_start=1 /product="uncharacterized protein LOC121371050" /protein_id="XP_041352607.1" /db_xref="GeneID:121371050" /translation="
MPGKKKGKGKGKGKGKGKGKGKGKGKKSVQSRDLVVMKNLLKQYDRNCVFTGSQPSASIRHIIKECIEQEKCLSKFILESANPEPEHPVLVEPLLVAFRQIRYDQMKDLHIWNYPMSYENCASLALLLEKPFCNIRLLELVDCLIEAYSINRLAKCFSSNQNLTTLNLDYNEFGDTGVMYLCQGLQDNSSVLSLSLCFCGLGIPSGRLLGKLISTTAVRELYLDGNDLECEGTLELIKLPVDQAEMEAFHRAQIVRLAEEEKLRKLEEEKTNRFKAGTSGESSTEDGGKSSNTSKKKKKGKKKKSKGPPAPPPIGPWIHKLHLADNGIDGMGNKGTFAPVIVMRLFKKLLAHSMCLEELDLEDNLIGDLGGQELKNALTLRKEAKLPSVKIRTTHRMSPNIFNSIVKLGSGLSKKKKKGKKKKK"
misc_feature <370..>753 /gene="LOC121371050" /note="protein phosphatase 1 regulatory subunit 42; Region: PPP1R42; cl42388" /db_xref="CDD:455733" misc_feature 1102..1182 /gene="LOC121371050" /note="Leucine rich repeat, ribonuclease inhibitor type; Region: LRR_RI; smart00368" /db_xref="CDD:197686" ORIGIN
tacatacagtatagttaacaacagtgacaacaaaccaactgaaagatgccgggtaagaaaaaaggaaagggcaaaggaaaaggcaagggaaaaggaaaaggcaagggcaaaggaaaagggaagaaatctgttcaatccagggatctagttgttatgaagaacttgttgaagcagtatgatcgcaactgtgtgtttactggatcacagccgagtgctagtataagacacattattaaagaatgcattgaacaggaaaaatgtctaagcaaatttatattagagtcagcaaatccggaacctgaacaccctgtattagtcgaacctctgctagtcgcattccgccagatccggtacgaccaaatgaaggatctccatatatggaattatccaatgtcatatgaaaattgtgcatctcttgcattgttattagagaaaccattttgtaatattcgtctgcttgaactggttgactgtctgattgaggcctactccattaacagactcgccaaatgtttttcatctaatcagaatttgacaactctaaatttggattataatgagtttggcgatacaggagtaatgtatctgtgtcagggactgcaggataacagcagtgtcttgtctctcagtctctgtttctgcggtctcggaattccgagcggaagactccttggaaagttgatttccaccacagctgtcagagaactctatttggatgggaatgacctggaatgtgaaggaacgctggagctcatcaaactccccgttgaccaggcggaaatggaggcgtttcacagagcacagatcgtgcgacttgcagaggaagagaaactccggaaactggaagaagaaaaaactaatcggtttaaagctggtacaagcggtgaaagctccacagaggatggagggaaatcatctaacacaagcaagaaaaagaagaaaggtaaaaagaaaaagtcaaagggccccccagcaccgcctcctataggaccatggatacacaagttacatttagccgacaatggcatcgatgggatgggaaataaaggcaccttcgccccagtgatcgtcatgagattgttcaagaaattgctggcacactccatgtgtttggaggaactcgaccttgaagacaacctgataggtgaccttggaggccaggagttaaagaatgctctcactcttagaaaggaagcgaaattgcccagcgtgaagatcagaacgactcaccgaatgagtcccaacatcttcaactccatcgtcaaactcgggtccgggctcagcaagaaaaagaaaaaaggcaagaagaaaaagaagtagaagacttagtaagatttttatcaaaatggattctctaaaccgggactacaagtctagcattctacacaccagtgtttggcgtaatggccatcacatagcaaggcaacacatggtgttgtcattgtcagtcaatgttttaagaattttgtttcaacagactctttagtgaaaatctgtgcagacataactatacattgaaatatttttgaataatgtaaagtaatgtgttttcttcttgttagtgatcattgtttatatgcccatctatagtgggtagtattatggtgtggtgttgtgcgtccattcatccgtatgtccgtctgttaattttttcttgtccggatcatatcttgcatacaggaccatcaaacctcacatgtaggaacaacttgggatggtggtgtgttgcgttctactactaggtcactgtgacctacttttcatggtctactgcacataacaataaatccttgttttgatcatatcttgcatacagatgaatacaggaccatcatatgtcacatgtaagaacaacttgggatggcggtgtgttgcgttctattactaggtcattgtgacctacttttcacagtctactgcacataacaataaatccttgtccagatcatatcttgcatacaga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]