GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 04:49:05, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_041351373            3456 bp    mRNA    linear   PLN 06-MAY-2021
DEFINITION  Suillus clintonianus NRDE-2, necessary for RNA
            interference-domain-containing protein (DEU56DRAFT_769881), mRNA.
ACCESSION   XM_041351373
VERSION     XM_041351373.1
DBLINK      BioProject: PRJNA727290
            BioSample: SAMN09062943
KEYWORDS    RefSeq.
SOURCE      Suillus clintonianus
  ORGANISM  Suillus clintonianus
            Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
            Agaricomycetes; Agaricomycetidae; Boletales; Suillineae;
            Suillaceae; Suillus.
REFERENCE   1  (bases 1 to 3456)
  AUTHORS   Lofgren,L.A., Nguyen,N.H., Vilgalys,R., Ruytinx,J., Liao,H.L.,
            Branco,S., Kuo,A., LaButti,K., Lipzen,A., Andreopoulos,W.,
            Pangilinan,J., Riley,R., Hundley,H., Na,H., Barry,K.,
            Grigoriev,I.V., Stajich,J.E. and Kennedy,P.G.
  TITLE     Comparative genomics reveals dynamic genome evolution in host
            specialist ectomycorrhizal fungi
  JOURNAL   New Phytol (2020) In press
   PUBMED   33355923
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 3456)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (05-MAY-2021) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3456)
  AUTHORS   Kuo,A., Lofgren,L.A., Vilgalys,R., Nguyen,N.H., Ruytinx,J.,
            Liao,H.-L., Branco,S., LaButti,K., Lipzen,A., Andreopoulos,W.,
            Pangilinan,J., Riley,R., Hundley,H., Na,H., Grigoriev,I., Barry,K.,
            Stajich,J.E. and Kennedy,P.G.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (22-APR-2020) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_024539228).
            
            ##Metadata-START##
            Organism Display Name :: Suillus clintonianus FC179 v1.0
            GOLD Stamp ID         :: Gp0255229
            ##Metadata-END##
FEATURES             Location/Qualifiers
     source          1..3456
                     /organism="Suillus clintonianus"
                     /mol_type="mRNA"
                     /strain="FC179"
                     /db_xref="taxon:1904413"
                     /chromosome="Unknown"
     gene            1..3456
                     /locus_tag="DEU56DRAFT_769881"
                     /db_xref="GeneID:64645551"
     CDS             161..3415
                     /locus_tag="DEU56DRAFT_769881"
                     /codon_start=1
                     /product="NRDE-2, necessary for RNA
                     interference-domain-containing protein"
                     /protein_id="XP_041214407.1"
                     /db_xref="GeneID:64645551"
                     /db_xref="InterPro:IPR013633"
                     /db_xref="JGIDB:Suicli1_769881"
                     /translation="
MSTPSFSSFPPSFASFPDLDPGPSRHTLDRTRNESSTDAREPREQDRKDKNRRGSKKLKDESRKDKKHKTAKHHLEPVLPRQHKHTRKGVSIPDDEKIKAEEDRRLAQSDIQGSQWDSRPVFFSDRKGDQLNVTYGSNHAGNVPKYHLVNRGRSILGLDGDWAIYRRGKGIEIIIGRRHKQPALTDSSVTTLLAAPPSQRLIGSGDSYKYEEVDGFLRLPSGHKAAEDYRSITKQQDHLDSDSQSSASNDSSGDESGTPILTSHQLSLKALEQQLAADPSSVETWLSLVRHSLSNIPLTSKNAAKARAEITLSILTRARAANPHNKSSRILFLKYLRAGEEVWHESKTKAEWEEALKLGGIEIWIEWLEWRIRTAAGGVETSVTDATRVFNALGSSESSEIDKLRVLWRVAVAFQQAGYHERTTALFQAQAELTFEVPQSLYGLPHESQLESLEEFWESEVPRAGEPGAKGWGDWMSCGRPDNPVSPLKAVPQMDVDDQLKDPYVQWHHDELCADRTSRVPARSVDTRSESDPYATVLLSDIKALLLPIRTEGAKNAFRLIWLSILGLHIPGLSETLSQGSWDDRWSFTYLSSFSRLESIFPAAAGQRQLIADSHAGTLIGREREFSNAFGPIKEWSRNALGPLEWVGEEKWRMWVAADLQEIDKEFVRAVFSQLRCGSEDYEWDIYALAFEAALNIKSALKLSRTFLSTARDSLPHWAAHARLERLREHVDDARKVYQTVLVTSQHTPTQPFVGQLWWDWAEMEWLSGDENAALRVIQRSVKIEGTGGMMVLRVKRSLDDTISCTHEHWKDREAWIKLRALVELLSSSSQDAALAVLDSQPAASVNEKPGRRESIMVASLMLLYNYSVMLRRPTPTAVLRDRLQIAVDTYPDNSLVLGMFLEAEKGHGIWGRVRAQLGQSTADGGPREKSISRRIAEVWVAGWEKVRWQSEIERTRSGLAAAAESERTTGSAILWRVILEFEIRVGELQRGKKLLYRAVNECPLAKDLYMLAFGPLRSVFSARELDGFVDIMAERGIRMRKGVDEYVERMKGGDESGSDNEDLDGSEDEIEHEARQRRLLMPY"
     misc_feature    524..>637
                     /locus_tag="DEU56DRAFT_769881"
                     /note="MTR4-interacting domain (MID) found in nuclear
                     exosome regulator NRDE2 and similar proteins; Region:
                     NRDE2_MID; cd22200"
                     /db_xref="CDD:412062"
     misc_feature    971..1861
                     /locus_tag="DEU56DRAFT_769881"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:400637"
ORIGIN      
cggtgaaactttaatacatacttcagatcaagcctggacagtttcgagaacgcgctacatagtgcctagcttcttgagcaccacaaagattactccagctgacacgatcgattacagcaaccggaattgttcgatgctcccgccttgagctctattcaaaatgtctacaccctcattttcttcctttccaccctcgttcgcctcgttcccagaccttgaccctggtccgagtaggcataccctggaccgaacgcgaaatgaaagctccacagatgctcgtgaacctcgggagcaggatagaaaggataagaaccgacgtggcagtaagaagttgaaagacgagtctcgaaaagacaagaagcataagacggcaaagcatcatcttgagccggtacttcccaggcaacataaacatacgcggaagggggtcagtataccggatgatgaaaaaatcaaggccgaggaggacagacgccttgctcagagtgatatccaaggcagccaatgggattctcgtccagtgttcttctctgataggaaaggtgaccaactgaatgtcacctacggcagtaatcacgctggcaatgtccccaagtaccatcttgtaaaccgtggtagaagtattcttggtcttgacggggactgggctatctatcgcagaggtaagggtatagagataatcatagggaggagacataagcaacccgccttgactgactcgagcgtaacgacgttattggcagcacccccgtcccaacgccttattggttccggtgacagttacaagtacgaagaggtggacggtttcttgcgactgccctccggtcataaagctgccgaagactatcgttctataacaaagcagcaagatcaccttgattcagactctcagtcgtctgcttcaaatgacagctcaggtgacgagtcaggaacacccattctcacatcacatcagctgtctttgaaggcactggagcagcagttggccgctgatccatcttcagtagagacgtggttgtcactcgtgagacactcattgtcgaacatacccctgacctcgaaaaatgcggccaaagctcgcgccgagataacactctctattctcacccgtgctcgtgctgccaatccgcacaacaagtcatcccgcattctattcctgaagtacctgagggcaggagaggaagtctggcacgagagtaaaaccaaggcagagtgggaagaagctcttaaactcggtggaattgaaatttggatcgaatggcttgaatggcgcattcgcaccgctgccggtggggtcgagacgtctgtcaccgatgcgacacgcgtctttaacgcactcggtagctctgagagcagcgaaattgataaactgcgagtcttgtggcgagttgcagtcgcattccaacaagcaggttaccatgaacgcactactgccttattccaggcacaagcggagctaacgttcgaggtaccccagtcattgtacggacttccccatgaatctcaactggaatccctggaggaattttgggagtccgaagtaccgcgcgccggcgagcctggagccaaaggttggggtgactggatgtcatgcggtagacctgacaaccccgtttccccactgaaggcggttccccagatggacgttgacgaccaattgaaagatccgtatgtccaatggcatcacgatgaattgtgcgccgatcgcacatcacgtgtgcctgcccgctctgtggacacaaggagcgagtctgacccatacgcgacagttctactttcggatatcaaggcactactattgcccatccgcacggaaggtgctaagaatgcttttcgccttatctggttatccattctaggcttgcacattcctggtctctcggaaactctgtcacagggatcttgggatgaccgatggtcattcacttacctgagttctttctcgcgattggagtcgatttttcctgctgctgcgggacagcggcaattgatcgctgactctcatgctggcacgctcataggaagggaaagagaattttcgaacgcattcggtccgatcaaagagtggagtagaaatgccctcggaccgttggagtgggtaggcgaagagaagtggcgaatgtgggttgccgctgatctgcaagagatcgacaaggagttcgtacgagctgtgttcagccagctcagatgcggtagcgaggactatgagtgggacatttacgctttagcatttgaggcggccctcaatatcaaaagtgctctgaagctctcgcggacattcttgtcgacagcacgagattccttaccgcactgggcagcccacgcacgtctcgagcgcttgcgcgagcacgtagatgatgcccgtaaggtctatcaaacggtgcttgtaacctctcagcacacacccacccagcctttcgttggccagttatggtgggattgggctgagatggaatggcttagtggtgacgaaaatgcggcactacgtgttatccagcgctcagtcaagatcgagggtacgggtggtatgatggttctccgtgtaaaacgcagcctcgatgatacgattagctgcactcacgagcattggaaggaccgggaggcttggataaaactacgagccttggtcgagctgctttcttcctcatctcaagatgcggcactcgcggtcttagactctcagcctgctgccagtgttaatgagaaacctggtcggagagagagcataatggttgcatctcttatgctactgtacaactattcagtcatgctacgacgtcctactccgacagctgtcctgagggatcgactacagattgccgtcgacacttacccggacaatagcctggtgttgggcatgtttctagaggctgagaaaggacacggtatctggggtcgcgtacgggctcaactcggacaaagcacggccgatggaggcccaagagaaaagagcatttcacggcgtatcgcagaagtgtgggtagcagggtgggagaaagtgcgatggcagagtgagatcgaacggacgaggagcggacttgctgcggctgcagagagcgaaaggactacaggaagcgctattttgtggcgcgtcattttggagtttgagattcgggtcggggagttgcaaagggggaagaagctgctttacagagcagtgaatgaatgtccgcttgccaaggatctatatatgttggcctttgggccgctgcgttcggtgtttagtgctcgtgagcttgatggattcgtggacattatggcggaaaggggtattcggatgaggaaaggtgtagatgaatacgttgagaggatgaagggtggagatgaaagcggttctgataacgaagatctggacggttccgaggatgagatcgaacatgaagcgaggcagaggcggctactaatgccatactagtacccgatgtacaaataagccacaacttatgattgttttgg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]