LOCUS       XM_041315421             327 bp    mRNA    linear   PLN 15-SEP-2021
DEFINITION  Suillus paluster uncharacterized protein (EDB91DRAFT_1081840),
            partial mRNA.
ACCESSION   XM_041315421
VERSION     XM_041315421.1
DBLINK      BioProject: PRJNA727282
            BioSample: SAMN10362844
KEYWORDS    RefSeq.
SOURCE      Suillus paluster
  ORGANISM  Suillus paluster
            Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
            Agaricomycetes; Agaricomycetidae; Boletales; Suillineae;
            Suillaceae; Suillus.
REFERENCE   1  (bases 1 to 327)
  AUTHORS   Lofgren,L.A., Nguyen,N.H., Vilgalys,R., Ruytinx,J., Liao,H.L.,
            Branco,S., Kuo,A., LaButti,K., Lipzen,A., Andreopoulos,W.,
            Pangilinan,J., Riley,R., Hundley,H., Na,H., Barry,K.,
            Grigoriev,I.V., Stajich,J.E. and Kennedy,P.G.
  TITLE     Comparative genomics reveals dynamic genome evolution in host
            specialist ectomycorrhizal fungi
  JOURNAL   New Phytol (2020) In press
   PUBMED   33355923
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 327)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-SEP-2021) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 327)
  AUTHORS   Kuo,A., Lofgren,L.A., Vilgalys,R., Nguyen,N.H., Ruytinx,J.,
            Liao,H.-L., Branco,S., LaButti,K., Lipzen,A., Andreopoulos,W.,
            Pangilinan,J., Riley,R., Hundley,H., Na,H., Grigoriev,I., Barry,K.,
            Stajich,J.E. and Kennedy,P.G.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (23-APR-2020) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_024537584).
            
            ##Metadata-START##
            Organism Display Name :: Suillus paluster FC165 v1.0
            GOLD Stamp ID         :: Gp0305073
            ##Metadata-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..327
                     /organism="Suillus paluster"
                     /mol_type="mRNA"
                     /strain="FC165"
                     /db_xref="taxon:48578"
                     /chromosome="Unknown"
                     /country="USA: Minnesota"
                     /lat_lon="48.1705 N 94.5118 W"
     gene            <1..>327
                     /locus_tag="EDB91DRAFT_1081840"
                     /db_xref="GeneID:64609314"
     CDS             1..327
                     /locus_tag="EDB91DRAFT_1081840"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_041177369.1"
                     /db_xref="GeneID:64609314"
                     /db_xref="JGIDB:Suipal1_1081840"
                     /translation="

MPPKRKSTAGGQLAGISRAGPGMVEISLMIPQPSTTIHQSSNAPMSHAINTGPWTPASHSCAQFAAGWEMIRQKVKMTWPMVVVNLSLESMKDNYLGLTVRDNKDNVG"

ORIGIN      

atgcctcctaaaagaaaatctacagcaggtggccaattggcagggatctctcgcgcagggccgggaatggtagagatcagcttgatgatcccccagccttccaccaccatccaccaatcgtccaatgcacccatgtcccatgccataaacacaggaccatggacaccagcaagccattcttgtgcccaatttgctgcaggatgggagatgatcaggcagaaggtcaagatgacctggcccatggtagtggtaaaccttagcctggaatccatgaaggacaactacttgggattgactgtcagggataataaggacaatgtaggttga

//