GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 05:59:47, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_040941760            3171 bp    mRNA    linear   PLN 20-APR-2021
DEFINITION  Aspergillus fijiensis CBS 313.89 putative RNA interference and gene
            silencing protein (BO72DRAFT_389317), partial mRNA.
ACCESSION   XM_040941760
VERSION     XM_040941760.1
DBLINK      BioProject: PRJNA722001
            BioSample: SAMN05660285
KEYWORDS    RefSeq.
SOURCE      Aspergillus fijiensis CBS 313.89
  ORGANISM  Aspergillus fijiensis CBS 313.89
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
            Aspergillus.
REFERENCE   1  (bases 1 to 3171)
  AUTHORS   Vesth,T.C., Nybo,J., Theobald,S., Brandl,J., Frisvad,J.C.,
            Nielsen,K.F., Lyhne,E.K., Kogle,M.E., Kuo,A., Riley,R., Clum,A.,
            Nolan,M., Lipzen,A., Salamov,A., Henrissat,B., Wiebenga,A., De
            vries,R.P., Grigoriev,I.V., Mortensen,U.H., Andersen,M.R. and
            Baker,S.E.
  CONSRTM   DOE Joint Genome Institute
  TITLE     The genomes of Aspergillus section Nigri reveals drivers in fungal
            speciation
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 3171)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-APR-2021) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3171)
  AUTHORS   Mondo,S., Kuo,A., Riley,R., Clum,A., Nolan,M., Lipzen,A.,
            Salamov,A., Vesth,T.C., Nybo,J., Theobald,S., Brandl,J.,
            Frisvad,J.C., Nielsen,K.F., Lyhne,E.K., Kogle,M.E., Henrissat,B.,
            Wiebenga,A., De vries,R.P., Mortensen,U.H., Andersen,M.R.,
            Baker,S.E., Grigoriev,I.V., Nordberg,H.P., Cantor,M.N. and Hua,S.X.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (12-FEB-2018) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_024469050).
            
            ##Metadata-START##
            Organism Display Name :: Aspergillus fijiensis CBS 313.89
            GOLD Stamp ID         :: Gp0047234
            ##Metadata-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..3171
                     /organism="Aspergillus fijiensis CBS 313.89"
                     /mol_type="mRNA"
                     /strain="CBS 313.89"
                     /culture_collection="CBS:313.89"
                     /type_material="culture from holotype of Aspergillus
                     fijiensis"
                     /db_xref="taxon:1448319"
                     /chromosome="Unknown"
     gene            <1..>3171
                     /locus_tag="BO72DRAFT_389317"
                     /db_xref="GeneID:63859093"
     CDS             1..3171
                     /locus_tag="BO72DRAFT_389317"
                     /codon_start=1
                     /product="putative RNA interference and gene silencing
                     protein"
                     /protein_id="XP_040796568.1"
                     /db_xref="GeneID:63859093"
                     /db_xref="InterPro:IPR003100"
                     /db_xref="InterPro:IPR003165"
                     /db_xref="InterPro:IPR014811"
                     /db_xref="JGIDB:Aspfij1_389317"
                     /translation="
MSDSRGWQRGRGRGGDRARGDRGRGGGGDRGRGGYRGGGGGGGGGGRGGGSGRGSFDLPFRPGDDGRGDGRGDGRGRGRPRGSDAFRGGRPPRGGKADYNGPEVFSPGGNLKPSSQVEEKEDAMMNALVKAPPSPKDSKYPRRPGYGTKGTRVDLFANYLQLKSIGKTLHRHRVEILEDQSVRRPTGKKAKQVIKLLIEEHFASQRNGVVTDFVSTLISRDKLLEEGENEHTYDVRYRDEYDDEYPEPSKVYRVKCQHTGTLEPSDLLDYLTSANATNMFDRKPEILQAMNIVLGHQPKIDPNIYSVGANRHFAIAQGQKEGYNLGDGLEALRGFFVSVRAATSRLLVNVQVKYAACYQEGALADLITSYQPNRFEFHSLQRFLKNLRIRATHIERKNKQGVIIPRFKRIASLANTGDGASLPHPPTVPRLGAGPNDVKFWLDEAGQQSSQQQSASSKKKGKKPATAGPPPAGRYISVAEFFNERYNMTNLDPRMPVMNVGTRENPSYLPVEVCNVEPGQQAKTKLSPYQTREMLKFAVNVPPVNAQSIVNNGTRILGLSAASNATLKEFGIQADPRLITVPGRILEAPQIFYKDANNKEKRLSSSGGSWNMRSIKFSIGSSLGSWAWLFLDSSPTRAPTREVLGAALEHFVTKLREVGVQANPPQGGERVVLARGDVDDQIGGAVKRLMAAHKPTMILGILTDQSTEVYNCMKRVCDVREGVRNVNVLVKNFTTDKGREQYLANVGLKVNLKLGGANQLIPRELGIVSKGKTMLVGIDVTHPSPGSSSKAPSVAGMVASIDSYLGQWPAELRIQTSRQERVSELDTMLKAHLGRWAKTNKGQYPDNIIVYRDGVSEGQYEMVVEEELPLLKSACKQLYPATEHAKGLPRISVVIVGKRHHTRFYPTRKEDADGHLNPKNGTVVDRGVTEARNWEFYLQAHTALKGTARPAHYFTVWDEIFCREKPKEGQNTADILEDLTHKMCYLFGRATKAVSICPPAYYADLVCERARCYLSDLYDATPTGSVVTGGGGGGAHAVDGGRVTIHPNVKDTMFYI"
     misc_feature    601..882
                     /locus_tag="BO72DRAFT_389317"
                     /note="N-terminal domain of argonaute; Region: ArgoN;
                     pfam16486"
                     /db_xref="CDD:406799"
     misc_feature    922..1077
                     /locus_tag="BO72DRAFT_389317"
                     /note="Argonaute linker 1 domain; Region: ArgoL1;
                     pfam08699"
                     /db_xref="CDD:400854"
     misc_feature    1117..1548
                     /locus_tag="BO72DRAFT_389317"
                     /note="PAZ domain, argonaute_like subfamily. Argonaute is
                     part of the RNA-induced silencing complex (RISC), and is
                     an endonuclease that plays a key role in the RNA
                     interference pathway. The PAZ domain has been named after
                     the proteins Piwi,Argonaut, and Zwille; Region:
                     PAZ_argonaute_like; cd02846"
                     /db_xref="CDD:239212"
     misc_feature    order(1222..1224,1432..1434,1444..1446,1498..1500,
                     1519..1521,1525..1527)
                     /locus_tag="BO72DRAFT_389317"
                     /note="nucleic acid-binding interface [nucleotide
                     binding]; other site"
                     /db_xref="CDD:239212"
     misc_feature    1696..3042
                     /locus_tag="BO72DRAFT_389317"
                     /note="PIWI domain, Argonaute-like subfamily. Argonaute is
                     the central component of the RNA-induced silencing complex
                     (RISC) and related complexes. The PIWI domain is the
                     C-terminal portion of Argonaute and consists of two
                     subdomains, one of which provides the...; Region:
                     Piwi_ago-like; cd04657"
                     /db_xref="CDD:240015"
     misc_feature    order(2128..2130,2140..2142,2176..2187,2194..2196,
                     2224..2226,2233..2235,2245..2247,2257..2259)
                     /locus_tag="BO72DRAFT_389317"
                     /note="5' RNA guide strand anchoring site [active]"
                     /db_xref="CDD:240015"
     misc_feature    order(2335..2337,2341..2343,2557..2559,3010..3012)
                     /locus_tag="BO72DRAFT_389317"
                     /note="active site"
                     /db_xref="CDD:240015"
ORIGIN      
atgtctgattctcgaggttggcaacgaggccgtggtcgcggcggtgaccgtgccagaggtgaccgtggtcggggaggaggcggtgaccgcggtcgtggaggttatcgtggcggcggcggcggcggaggtggtggtggtcgtggaggtggaagcggccgtggctctttcgatcttcccttccgtcctggagacgatgggaggggcgatggcaggggcgatggcaggggtcgtggtcgtcccagaggttccgatgcatttcgtggcggtcgcccgccacgcggcggaaaagctgactacaacggcccggaggtcttctcccccggcggaaacctcaaacccagctcccaggtcgaagagaaggaggatgcgatgatgaacgcattggtcaaggcaccgccctcgcccaaagacagcaaatacccccgccgtcccggctacggtacgaagggaacgagagtcgacttattcgccaactatcttcagctcaagtcgatcggcaaaaccctccaccgccatcgcgtcgaaattctcgaagaccagtccgtcaggaggcctaccggcaagaaggcgaagcaagtcatcaaactgttgattgaggagcattttgcttcgcagcgaaatggcgttgtcaccgacttcgtctccactctcatctcccgggataagcttctggaggaaggcgagaatgagcacacgtatgacgtccgctaccgggatgaatacgacgatgaatatccagagccatcaaaggtctatcgggtgaagtgccagcacaccggcactctcgaaccgtccgatctcttggactacttgacctcagccaatgcgacaaatatgttcgacagaaagccagagattctccaagctatgaacattgtcctgggccatcagcccaaaatcgacccgaacatttactcagtgggtgccaatagacactttgccatcgctcagggtcagaaagagggttacaacctcggagatgggctcgaggctcttcgtggattttttgtgagcgtccgtgctgcaactagtcgcctgctcgtcaatgttcaagtcaaatatgcggcctgctaccaggagggcgcgctagcggacttgataaccagttatcagcccaaccgtttcgagttccactccctgcaacgtttcttgaaaaacttgagaatccgggcaacacacattgaacgcaaaaacaagcagggagtaatcatcccacgtttcaagagaatcgctagtctggctaacacgggagatggcgcatcgctgccacatcctccgacggtccctcgtctgggagccggtcccaatgatgtgaaattctggttggacgaagctggccaacagtcatcgcagcagcagtccgcatcctcgaagaagaagggcaaaaagccagccacagctgggcctccgccggctggaagatacatcagtgtggcggaattcttcaacgagcgttacaatatgacaaatctagatccccgaatgccagtgatgaatgtcgggactcgcgagaatcctagctatttacccgtcgaagtctgcaacgtcgaacctgggcagcaagctaagaccaagctgagcccctaccagacaagggaaatgttgaaatttgcagtcaatgttccgccagtcaacgctcagtcaattgtgaataatggaactcgcatcctcgggctcagtgctgcttcaaatgctactttgaaagagtttggtatccaagcagatccccgactcatcacagtacccggccgcatccttgaggcccctcagatcttctacaaagacgcaaacaacaaagagaagagactctcgtccagcggtggcagctggaatatgaggtctatcaaattctcaatcggctcaagcttaggttcctgggcctggcttttcttggactccagcccaactagagcccccacgcgtgaggtactgggggccgccctggaacattttgtgacgaagctgagagaggtcggggttcaggctaatccccctcaaggcggagagcgcgtcgttctcgctcgcggtgacgtggatgatcagattggtggcgctgtcaagagactgatggccgctcataagcctaccatgattcttggtattcttaccgaccaaagcacggaagtttataactgcatgaagcgagtctgtgacgttcgggagggtgtccgcaatgtgaatgtgcttgttaaaaacttcacgactgacaagggccgcgaacaatacctcgccaacgtcggtctgaaggtcaatctgaagctcgggggtgcgaatcagctgattcctagagagcttgggatagtgagcaagggcaagactatgcttgttggtatcgatgtgacccacccctctcccgggtcatcctcaaaagcccccagtgttgcgggaatggttgcctcgattgattcctacttgggtcaatggccagcagaacttcggatccaaacatcgcgccaagaaagggtcagtgagttggacacgatgctgaaagctcacctcggtcggtgggctaaaaccaacaagggtcagtatccggataatattattgtctaccgcgacggagtctctgaagggcagtatgaaatggttgtcgaagaagaactacccctcctcaaaagcgcttgcaagcagctgtacccagcaacggagcatgccaaagggctaccacggatctcggtcgtgattgtgggcaagcggcatcacacgcgtttctatcctacgcgtaaagaggacgccgatggccacttgaatcctaagaatggtactgtggtcgaccgcggtgtgacggaagcccgcaactgggagttctacctacaggctcacactgctctcaagggcaccgctcgcccggcacactattttactgtttgggacgagatcttctgtcgagagaaacccaaggaaggacagaacacagctgacatcctggaagacctcacgcacaagatgtgctatctgttcggacgggcgaccaaggccgtgagcatctgccctcctgcatattatgccgatctggtctgcgagcgagcgcgatgctatttgtctgatctgtacgatgcgacgccgaccggtagcgttgtcaccggcggtggtgggggtggtgctcatgccgtggacggcggcagggtcaccatccatcccaacgtcaaggatacgatgttctacatttga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]