GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 05:32:25, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_040861717            3240 bp    mRNA    linear   PLN 20-APR-2021
DEFINITION  Pseudomassariella vexata NRDE-2, necessary for RNA
            interference-domain-containing protein (BCR38DRAFT_454635), partial
            mRNA.
ACCESSION   XM_040861717
VERSION     XM_040861717.1
DBLINK      BioProject: PRJNA721998
            BioSample: SAMN05421895
KEYWORDS    RefSeq.
SOURCE      Pseudomassariella vexata
  ORGANISM  Pseudomassariella vexata
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Sordariomycetes; Xylariomycetidae; Xylariales; Pseudomassariaceae;
            Pseudomassariella.
REFERENCE   1  (bases 1 to 3240)
  AUTHORS   Mondo,S.J., Dannebaum,R.O., Kuo,R.C., LaButti,K., Haridas,S.,
            Kuo,A., Salamov,A., Ahrendt,S.R., Lipzen,A., Sullivan,W.,
            Andreopoulos,W.B., Clum,A., Lindquist,E., Daum,C.,
            Ramamoorthy,G.K., Gryganskyi,A., Culley,D., Magnuson,J.K.,
            James,T.Y., O'malley,M.A., Stajich,J.E., Spatafora,J.W., Visel,A.
            and Grigoriev,I.V.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Pervasive Adenine N6-methylation of Active Genes in Fungi
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 3240)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-APR-2021) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 3240)
  AUTHORS   Mondo,S.J., Dannebaum,R.O., Kuo,R.C., LaButti,K., Haridas,S.,
            Kuo,A., Salamov,A., Ahrendt,S.R., Lipzen,A., Sullivan,W.,
            Andreopoulos,W.B., Clum,A., Lindquist,E., Daum,C.,
            Ramamoorthy,G.K., Gryganskyi,A., Culley,D., Magnuson,J.K.,
            James,T.Y., O'malley,M.A., Stajich,J.E., Spatafora,J.W., Visel,A.,
            Grigoriev,I.V., Nordberg,H.P., Cantor,M.N. and Hua,S.X.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (28-JUL-2016) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_024467957).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..3240
                     /organism="Pseudomassariella vexata"
                     /mol_type="mRNA"
                     /strain="CBS 129021"
                     /culture_collection="CBS:129021"
                     /type_material="culture from epitype of Pseudomassariella
                     vexata"
                     /db_xref="taxon:1141098"
                     /chromosome="Unknown"
     gene            <1..>3240
                     /locus_tag="BCR38DRAFT_454635"
                     /db_xref="GeneID:63777929"
     CDS             1..3240
                     /locus_tag="BCR38DRAFT_454635"
                     /codon_start=1
                     /product="NRDE-2, necessary for RNA
                     interference-domain-containing protein"
                     /protein_id="XP_040719630.1"
                     /db_xref="GeneID:63777929"
                     /db_xref="InterPro:IPR013633"
                     /db_xref="JGIDB:Pseve2_454635"
                     /translation="
MSSKGGKKPSVPKFSSFKPKPVPVEQTEGPPTPAADPGLITRGSHLRAHRHRSHATEESRERDRGNHDSSTRQSNVSRRPGPSEDFKEGSFTIDKRGDPLIRKYGSNHRYDVPAYRRFGSGRLLGADGFLRIERLGNRDEFFIRGYYEGGSALRGDRKSVLARGIHNKSQPIRVRQESSQAPTLTEDFLPLKSSKKRKWPNDPSSESSGEEGQSYRSIHGKSKVHEHSESDELYGSDSSASSTGSDRRRFVDPVKAKEISLSARVRDHPEDIDAWLELVNHQNTLLRMRAADGQRATQAEIKSFADIKLSLLEKGLAHADSPEQRDKLLLRIMREGSKIWDRKTVIKRWEDLMKDHSANFALWKAYVNFRQTDLPTFRYDDIKQLYVNRLRSIETAMTQDTSNTQSQELYDQLVLVFLKATRFVADAGFVELAVAAWQAMLELLFCRPVTAPDASASTMIASFQNFWESEVPRIGEEFAKGWFTYEADGGKQDAPEPRSFGVGQTPNTRDAYKAWTATEQQRAANAKVPARTMDDGTEDDPYRVVMFADIQDFLVFIPEKNLPMIQTLMLDAYLIFCQLPPAVGTSKAVKVIMQDELLNSGRNSVFEVKEVTNSIAPGQQHMDEESTKTPDFAHDYQQMAISSETLFPPSKWFRCIQAMRGSTSDQHKLILNTLKQLARSFGREEIAPYSLAFDSLDETIDDKKTAKALLKKYSTNIGLYIGYANLENARGNRDTARNVLSAALSLPTNSTHDRLRLCIASAWIDLEDGNIPGSISRILMVATDASNETASSTTQLLKARQLLGSNRDYLISSGDSGTAAIYGEGLALLEYATQTSGKEPQSEGQGDIWSAMSCVSACSDDFSSRGLAESLSHERLLQFTARLLYHHATHGPFRPAFLRDQFAKFVHFFPQNTMFLSLYAWRETRLSIDDRVRSLLDQHVLVPPHDCVSSRVFAIRHEMKTGNSHSTCAAFEHALESDEETGCRHHPGLWISYMRFCRERKELRHKAKDVFYRAVQSYPGSREVFIEAFVTLVEEMDSAELKAVYNTLSEKGLRVHVELQEFVEGWESAQKQKMMGGGR"
     misc_feature    268..>360
                     /locus_tag="BCR38DRAFT_454635"
                     /note="MTR4-interacting domain (MID) found in nuclear
                     exosome regulator NRDE2 and similar proteins; Region:
                     NRDE2_MID; cd22200"
                     /db_xref="CDD:412062"
     misc_feature    781..1734
                     /locus_tag="BCR38DRAFT_454635"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:400637"
ORIGIN      
atgtcgtctaaagggggtaaaaaaccgagtgttcccaaattctcctccttcaagccaaaaccagtcccagtggagcaaacggaaggaccgcccactcccgcagctgatccaggtttgatcaccagagggagccaccttcgtgcacaccgtcatcggtcccatgctacagaggaatcgcgtgagcgagatcgagggaatcacgattcgtccacaaggcagtcaaacgtctcccggcgtccgggaccatcagaagatttcaaggaagggtcattcactattgacaagcgaggcgatcccctcatcagaaagtacggcagtaaccaccgctacgatgttccggcctatcgcaggttcgggtctggtcgtcttctgggagcagatggcttcttgagaattgagcgtctaggaaatcgtgatgagtttttcatacgtgggtactacgaaggaggttctgctcttagaggggatcggaagagcgtacttgcaaggggtatccacaataagtcacaacccatccgagttcgacaagaatcttcgcaggcgcctaccctaacagaggatttcctaccgttgaagtcctccaagaagcgaaaatggcctaatgatccttcaagcgagtcgtccggtgaggaaggacagtcttacagatcaatccacgggaagagcaaggtgcatgagcactctgaaagcgatgaactatacggcagtgactcgtcagcttcatctacgggatctgatagacgccgtttcgttgatcccgtgaaagcaaaggaaattagcctgtctgcaagggtgagagatcacccggaagacatcgatgcgtggcttgaactcgtcaaccatcaaaatactttgctgcgaatgagggcagccgatggacagcgagcaactcaggccgaaatcaagagttttgctgacatcaagctttccctgctcgagaaaggcctcgctcatgctgattcccctgagcaacgggacaagttgctattgcggattatgcgtgaaggctccaaaatctgggatcgcaaaacagttataaagcgctgggaggatttgatgaaagatcatagtgccaacttcgcgctgtggaaggcatatgtgaattttcggcagactgatttaccaacgtttcgatatgatgacatcaaacaactttatgtcaatagactgcggagtatcgaaaccgcaatgacacaagatacttcaaacactcagagccaagagttgtatgatcagctggttttggtcttcttgaaagccacccggttcgtcgcggatgctgggttcgtcgaactcgcagtggcagcatggcaagctatgctggaactccttttctgtcgccctgtgactgcccctgatgccagcgccagtacgatgattgcgtctttccaaaacttttgggaaagtgaagtgccacgtattggcgaagagtttgcaaaagggtggtttacttacgaagccgacggtggcaagcaagatgcccctgaaccccggtccttcggggttggccaaacgccgaatactcgggatgcgtacaaggcatggacagccactgagcagcaaagagctgcaaacgcaaaggttccagctcgcaccatggatgacgggacggaagacgatccatacagagttgtcatgttcgcagatatccaagattttctcgtatttattccagaaaaaaacctgcccatgatacagaccctgatgcttgatgcctacctgatcttctgtcagctacccccggcggttgggaccagcaaagccgtcaaggtcatcatgcaagatgaacttctcaatagtggcagaaacagcgtctttgaagtgaaggaggtgacgaattcaatcgctccaggtcaacaacacatggatgaagagtccaccaagacgccggattttgcgcacgattaccaacaaatggcaatatcgtcggagacgctcttccctccgtcaaaatggtttagatgcattcaggcaatgagagggagcacttcggatcagcacaagctgatcttgaatacgctgaaacaactggcacgctcattcgggcgtgaggaaattgccccttactctctggcctttgacagtctcgatgaaacaattgacgacaagaagacagcaaaggcgcttctgaagaagtattcaacgaacatcggactctatattggatacgcaaaccttgaaaacgccagaggaaacagagacaccgcccgcaacgtattatctgctgctctgagcttgccaacaaattcgacgcacgacagactacggctctgcatcgcctcggcgtggatagatcttgaggatggcaacatacctggaagcatatctcgaatacttatggtagcgaccgatgcatcgaacgaaacagcgagctctacgacccaacttttgaaggcgagacaactgctggggtcaaatcgagactatctcatatcctcgggtgattctggaactgccgccatctacggtgagggattggccttgttagaatatgcgacgcaaaccagcggcaaggaaccacaatctgaaggtcagggtgatatatggtctgctatgagctgcgtttcagcctgttccgacgacttcagctctcgaggtctcgcagagagcctaagccatgaaagattgctacaattcacggcccgtcttctctatcatcatgctacccacggacccttccgacccgcattcttacgggaccaattcgcaaagttcgtccacttcttcccgcagaacaccatgttcctgagcttatacgcatggcgtgaaacccgcctcagcattgacgaccgcgtgcgctccctcctagaccagcacgtcctcgtgcccccacacgactgcgtcagtagccgcgtcttcgccatccgccacgagatgaagacgggcaactcccattccacctgcgccgcgttcgagcacgctctcgagagtgacgaggagacgggctgcaggcaccatccgggattgtggatatcgtacatgcggttctgccgcgagagaaaggagctgagacataaggccaaggacgtgttctaccgcgcggtgcagagctatcccgggtcgagggaggtgtttatcgaggcttttgttacgctggtagaggagatggactcggctgagttgaaggcggtgtataatacgcttagtgagaaggggttaagggtgcatgtagaactgcaggaatttgtggaggggtgggagagcgctcagaagcagaagatgatgggtggtggccgatga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]