2024-04-20 11:32:08, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_040756630 2845 bp mRNA linear ROD 14-APR-2021 DEFINITION PREDICTED: Mesocricetus auratus protein argonaute-1 (LOC101838170), transcript variant X3, mRNA. ACCESSION XM_040756630 VERSION XM_040756630.1 DBLINK BioProject: PRJNA719779 KEYWORDS RefSeq. SOURCE Mesocricetus auratus (golden hamster) ORGANISM Mesocricetus auratus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Cricetidae; Cricetinae; Mesocricetus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_024429197.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Mesocricetus auratus Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.6 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2845 /organism="Mesocricetus auratus" /mol_type="mRNA" /isolate="SY011" /db_xref="taxon:10036" /chromosome="Unknown" /sex="female" /tissue_type="liver" /dev_stage="adult" gene 1..2845 /gene="LOC101838170" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 6 samples with support for all annotated introns" /db_xref="GeneID:101838170" CDS 192..2549 /gene="LOC101838170" /codon_start=1 /product="protein argonaute-1 isoform X3" /protein_id="XP_040612564.1" /db_xref="GeneID:101838170" /translation="
MVQHFKPQIFGDRKPVYDGKKNIYTVTALPIGNERVDFEVTIPGEGKDRIFKVSIKWLAIVSWRMLHEALVSGQIPVPLESVQALDVAMRHLASMRYTPVGRSFFSPPEGYYHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIEFMCEVLDIRNIDEQPKPLTDSQRVRFTKEIKGLKVEVTHCGQMKRKYRVCNVTRRPASHQTFPLQLESGQTVECTVAQYFKQKYNLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLMKNASYNLDPYIQEFGIKVKDDMTEVTGRVLPAPILQYGGRVSRNRAIATPNQGVWDMRGKQFYNGIEIKVWAIACFAPQKQCREEVLKNFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVVKTSPQTLSNLCLKINVKLGGINNILVPHQRSAVFQQPVIFLGADVTHPPAGDGKKPSITAVVGSMDAHPSRYCATVRVQRPRQEIIEDLSYMVRELLIQFYKSTRFKPTRIIFYRDGVPEGQLPQILHYELLAIRDACIKLEKDYQPGITYIVVQKRHHTRLFCADKNERIGKSGNIPAGTTVDTNITHPFEFDFYLCSHAGIQGTSRPSHYYVLWDDNRFTADELQILTYQLCHTYVRCTRSVSIPAPAYYARLVAFRARYHLVDKEHDSGEGSHISGQSNGRDPQALAKAVQVHQDTLRTMYFA"
misc_feature 234..458 /gene="LOC101838170" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 486..638 /gene="LOC101838170" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 639..1001 /gene="LOC101838170" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(795..797,840..842,882..884,894..896,948..950, 969..971,975..977) /gene="LOC101838170" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1134..2420 /gene="LOC101838170" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1554..1556,1566..1568,1602..1613,1620..1622, 1644..1646,1653..1655,1665..1667,1677..1679) /gene="LOC101838170" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1758..1760,1764..1766,1974..1976,2388..2390) /gene="LOC101838170" /note="active site" /db_xref="CDD:240015" ORIGIN
ggcactgtgggcaaaccaatcaagcttctggccaattactttgaggtggacattcctaagattgacgtttatcattacgaggtggacatcaagccggataagtgtcctcgcagagtcaaccgaagcctgaaacgaaattactcaagcttccacctgccacgtctgtcttccacagggaagtggtggaatacatggtccagcatttcaagcctcagatctttggggatcgcaagcctgtatatgatggaaagaagaacatttacactgtcactgcactgcccattggcaacgagagggttgactttgaggtgacaatccccggggaagggaaagacagaatttttaaggtctccatcaagtggctagccatcgtgagctggcgtatgctacatgaagccctggtcagtggccagatccctgtgcccttggagtctgtgcaagccctggatgtggccatgaggcacctggcatccatgaggtacacccctgtgggccgctccttcttctcaccgcctgagggctactaccacccgctggggggtgggcgcgaggtctggttcggctttcaccagtctgtgcgccctgccatgtggaagatgatgctcaacattgatgtctcagctactgccttctacaaagcacagccagtgattgagtttatgtgtgaggtcctggacatcaggaacatagatgaacagcccaagcccctcacagattcccagcgtgttcgctttaccaaggagataaaaggcctgaaggtggaggtgacccactgtggacagatgaagaggaaataccgcgtgtgtaatgttacccgacgccctgctagtcatcagacgtttcccttgcagctagagagtggacagactgtggagtgtaccgtggcacagtatttcaagcagaaatataaccttcagctcaagtatccccacctgccctgcctacaagttgggcaagaacagaagcatacctatttgcccctcgaggtctgtaacattgtggctgggcagcggtgcattaagaagttgactgacaaccagacctcaaccatgataaaggctacagctaggtcggccccagacagacaggaggagatcagtcgcctgatgaagaatgccagctacaacttagatccctacatccaggaatttggaatcaaagtgaaggatgacatgacggaggtgaccgggcgagtgctgccggcgcccatcttgcaatatggcggccgggtgagcaggaaccgggccattgctacacccaaccaaggtgtctgggacatgcgtgggaagcaattctacaatggcattgagatcaaagtctgggccatcgcctgcttcgcaccccaaaagcaatgtcgagaagaggtgctcaagaacttcacagaccagctgcggaagatttccaaggatgcagggatgcccatccagggtcagccttgtttctgcaaatatgcgcagggagcagatagtgtggagcccatgttccggcatctaaagaatacatattcaggactgcagctcattatcgtcatcctgccagggaagacgcctgtgtatgctgaagtgaaacgtgttggagatacactcttgggaatggcaacacagtgtgtacaggtgaagaatgtggtcaagacctcacctcagactctgtccaatctctgtctcaagatcaatgtcaagcttggtggcattaacaacatcctagtgccacaccagcgctctgctgtttttcaacagccagtgattttcctgggcgcagatgttacacaccccccagccggggatgggaagaagccgtctatcacagcggtggtaggcagtatggatgcacaccccagccgatactgtgctactgtgcgtgtgcaacgcccacggcaggagatcattgaagacttgtcctatatggtgcgtgagctgctcatccagttctacaagtccacccgcttcaagcctacccgcatcatcttctaccgagatggggtccctgagggccagctaccccagatccttcactatgagctgcttgccattcgagatgcctgcatcaaactggaaaaagactaccagcctgggatcacttacattgtggtgcaaaaacgtcatcatacccgccttttttgtgctgacaagaatgagcgaattgggaagagtggtaacatccccgctgggaccactgtggacaccaacatcactcacccatttgagtttgacttctatctgtgcagtcatgcaggcatccagggtaccagccgaccatcccattactatgtcctttgggatgacaaccgtttcacagcagatgaactccagatcttgacataccagctgtgccacacttatgtacgatgcacacgttctgtctctatcccagcacctgcctactatgcccgattggtggctttccgggcacgataccacctggtggacaaggagcatgacagtggagagggaagccacatatcggggcagagcaatgggcgagaccctcaggccctggccaaagctgtgcaggttcaccaggatacgctacgcaccatgtacttcgcttgaaggcagaatgctgttacctcactggagagaagaaagctttccaagccctgggagctgtaccacccaaatccagaggaaccaaggaagagggaggtggggtcgggagtataagaggccttgtttctgtctacagaggggatataagggtgggaagagggccagcaagacagactaccagccagaaatctctgatagaaacctcatgtcctctaccctctccccatcttgtcatatccgaccccactggaccaaaatgggcagcactagtgcccaccatacacacagttgtctcatgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]