GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-16 07:17:34, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_040293041            3567 bp    mRNA    linear   ROD 22-MAR-2021
DEFINITION  PREDICTED: Ictidomys tridecemlineatus nuclear factor kappa B
            subunit 1 (Nfkb1), transcript variant X4, mRNA.
ACCESSION   XM_040293041
VERSION     XM_040293041.1
DBLINK      BioProject: PRJNA714113
KEYWORDS    RefSeq.
SOURCE      Ictidomys tridecemlineatus (thirteen-lined ground squirrel)
  ORGANISM  Ictidomys tridecemlineatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciuromorpha; Sciuridae; Xerinae; Marmotini; Ictidomys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024405301.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Ictidomys tridecemlineatus
                                           Annotation Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.6
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3567
                     /organism="Ictidomys tridecemlineatus"
                     /mol_type="mRNA"
                     /isolate="GS200"
                     /db_xref="taxon:43179"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver"
                     /collection_date="2010"
                     /collected_by="Sandy Martin, University of Colorado,
                     Anschutz Medical Campus"
     gene            1..3567
                     /gene="Nfkb1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 3 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:101972573"
     CDS             392..2920
                     /gene="Nfkb1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X3"
                     /protein_id="XP_040148975.1"
                     /db_xref="GeneID:101972573"
                     /translation="
MVVGFANLGILHVTKKKVFETLEARMTDACVRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKELIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGVWEGFGDFSPTDVHRQFAIVFKTPKYKDVNITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGSGAGAGGGGMFGSGGGGGSTGSTGPGYGFPHYGFPTYGGITFHPGTTKSNAGLKHGTMNDVSKRDPEDCGKSGGREIVNLSGNIIKTTEQDKLGMSMDRNEEVTLLCTRGVKEEDSLFQDNLFLEKAMQLAKRHANALFDYAVTGDVKMLLAVQRHLTAVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEDVVEDLLSAGADLSLLDRLGNSVLHLAAKEGHDKVLSVLLKHKKAALLIDHPNGEGLNAIHIAVMSNSLPCLLLLVAAGADVNAQEQKSGRTALHLAVEHDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTKLAALLKAAGADPLVENFEPLYDLDDSWEKAGEDEGVVPGTTPLDMAANWQVFDILNGKPYEPEFTSEDLLAQGDMKQLTEDAKLQLYKLLEIPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIKELVEALRQMGYTEAIQVIQAAFCTSEASSPVKTTSQAHSLPFLPSSTRQQIDELRDNDSICDSGVETSFRKLSFTESLTSSSSLLTLNKMPHDYGQEGPIEGKI"
     misc_feature    <392..727
                     /gene="Nfkb1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD); Region: RHD-n; cl08275"
                     /db_xref="CDD:447596"
     misc_feature    746..1051
                     /gene="Nfkb1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(749..751,755..763,767..775,893..901,938..940,
                     974..976,1031..1033,1040..1042,1046..1048)
                     /gene="Nfkb1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(755..760,764..766,803..805,809..811,815..817,
                     914..919,926..928,932..934)
                     /gene="Nfkb1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(818..820,824..826,917..922)
                     /gene="Nfkb1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    <1607..1831
                     /gene="Nfkb1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    order(1619..1621,1625..1627,1637..1642,1649..1657,
                     1661..1666,1676..1678,1685..1687,1730..1732,1736..1738,
                     1742..1744,1754..1759,1766..1774,1778..1783,1793..1795,
                     1802..1804,1829..1831,1835..1837,1841..1843,1853..1858,
                     1865..1873,1877..1882,1892..1894,1901..1903)
                     /gene="Nfkb1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1619..1732
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1736..1831
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1751..2035
                     /gene="Nfkb1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    1943..2035
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1958..>2188
                     /gene="Nfkb1"
                     /note="Ankyrin repeats (3 copies); Region: Ank_2;
                     pfam12796"
                     /db_xref="CDD:432791"
     misc_feature    2045..2143
                     /gene="Nfkb1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2441..2665
                     /gene="Nfkb1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      
agaggatttcgtttccgttatgtttgtgaaggcccatcccatggcggacttcctggtgcatctagtgagaagaacaagaagtcctaccctcaggttaaaacaacttgttttccaacccatctgcggatctagaggtgatgctgaagctttcctgtggtctccatcctttctcccatcctggtagaatcctcccctggtggattccagagcagagtccttcagcccaccttcacttccttgaagtctcctggagatttgcaactatgtgggacctgcaaaggtgattgttcagttggtcacaaatgggaaaaatatccacctgcacgcccacagcctggtgggaaaacactgtgaggatggaatctgcactgtgaatgccggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtatttgaaacactggaagcacggatgacagacgcgtgtgtcaggggctacaatccgggacttctcgtgcatcctgaccttgcctatttgcaagcagaaggtggaggagaccggcagctcacagatcgggaaaaggagctcatccgccaggcggctcttcagcagactaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttcccgacagcaccggcagcttcaccaggcgcctggaacccgtggtgtcagacgccatctatgacagcaaagcccccaatgcatccaatttgaaaattgtaagaatggacaggacagctggatgtgtaactggaggggaagaaatttatcttctctgtgacaaagttcagaaagatgatatccagattcggttttatgaagaggaggaaaatggtggagtttgggaaggatttggagatttctcccccacagatgttcatagacaattcgccatcgtcttcaaaaccccaaagtataaagatgtcaacattacaaagccagcctctgtcttcgtccagcttcggagaaaatctgatttggaaactagtgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaaacggcagaagctcatgcccaatttttcagatagtttcggcggcggcagtggtgccggggctggaggtggaggcatgttcggtagcggcggtggaggagggagcactggaagtacgggtccagggtacggcttcccgcactatggatttcctacatacggtggaattaccttccaccctggaaccactaaatccaatgctgggctgaagcatggaaccatgaatgatgtatctaaaagggatcctgaagattgtggcaagagtggtggcagagagattgtaaatctctctgggaacattatcaaaaccacagaacaagataaactgggcatgtccatggacagaaatgaggaggtgacgctgctgtgcaccaggggagtaaaggaagaggactctctgtttcaggataacctctttctggagaaggctatgcagcttgccaagcggcatgccaacgcccttttcgactatgcggtgacgggagatgtgaagatgctgctggctgtccagcggcacctcactgcagtgcaggatgagaatggggacagtgtcttacacttagccatcatccaccttcatgctcagcttgtgagagatctgctagaagttacatctggtttgatttctgatgacattatcaacatgagaaacgatctgtaccagacgcccttgcacttggcagtgatcactaagcaagaagatgtggtagaggacttgctgagtgccggggctgacctgagccttctggaccgcttgggtaactctgttttgcacctagctgccaaagaaggacatgataaagttctcagtgtcttactcaagcacaaaaaggcagcactacttatcgatcatcccaacggggaaggtctgaatgccattcacatagccgtgatgagcaacagcctgccgtgtctgctgctgctggtggccgccggagcagacgtcaatgctcaggagcagaagtccgggcgaacagcactgcacctggctgtggagcatgacaacatctccttggcaggctgcctgctcctggagggagatgcccacgtagacagtaccacctatgatggaactacacccctacacatcgcagccgggagagggtccaccaagctggcagctcttctaaaagcagcaggagcagatcccctggtggagaactttgagcccctttatgacctggatgactcttgggaaaaggcaggagaggacgaaggggttgtgcctggaaccacacccctagacatggccgccaactggcaggtatttgacatcttaaatgggaagccgtatgagccagagtttacatctgaggatttgctggcacaaggagacatgaaacagctgaccgaagatgcaaaactgcagctctacaagttgctagaaatccctgatccagacaaaaactgggctactctggcacagaagttaggtctggggatacttaataatgctttccggctgagtcctgctccttccaaaactctcatggacaactatgaggtctctggggggaccatcaaagagctggtagaggccctgagacagatgggctacaccgaagcaatccaagtgatccaggcggccttctgcacctcggaagcctccagccccgtgaagaccacctctcaggcccactcactgcctttcttgccttcctctacaaggcagcaaatagatgagcttcgagacaatgacagcatctgtgacagtggtgtggagacatccttccgcaaactcagctttacagagtctctgaccagcagcagctcattgctaactctcaacaaaatgccccacgattatgggcaggaaggacctatagaaggcaaaatttagccttcgggcagtttcccatgctgtgtaaaccaaagtcctaaaattccactgcattgtccaaaagaaggaaggtaaagtgcatccagaggtgctcagaggaacagcggcctgcctgaatcatgctggatttaattcaaggccgtctaaacgtggcttcctttcctggtttttcaatgagttttagttgattcacttgcagataagtatctagcaatccccctcactgcactgaactgatgtgacctggggatgaggtagtttattgagctttactggctgctgctggattacagttgctttttttgtcgtcattgctgctgtccctctgctgcattcccactgtcattaaagggtgtccccacctggtgttctttctagccgtccagggcacagttgtgcattcagattaaggattaagaaaagaggtgttttaaaatcagagtcacttagtgtgcaattaaaaaagaaaggctcattgctttttctaatgtggttatctcagtgatttggaaaaaagaagaatttatcaatatttaaacatggttataatcagtgccgaaaatgatattttcccctttttctgcattttgctattgtaaatatgtttttttttagatcaaatactttaaaggaaaaatgttggattt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]