2024-04-20 17:32:57, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_039851022 2820 bp mRNA linear MAM 02-MAR-2021 DEFINITION PREDICTED: Pteropus giganteus argonaute RISC catalytic component 3 (AGO3), transcript variant X3, mRNA. ACCESSION XM_039851022 VERSION XM_039851022.1 DBLINK BioProject: PRJNA703023 KEYWORDS RefSeq. SOURCE Pteropus giganteus (Indian flying fox) ORGANISM Pteropus giganteus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Megachiroptera; Pteropodidae; Pteropodinae; Pteropus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_024353787.1) annotated using gene prediction method: Gnomon, supported by mRNA evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Pteropus giganteus Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2820 /organism="Pteropus giganteus" /mol_type="mRNA" /isolation_source="ENVO:00010625" /db_xref="taxon:143291" /chromosome="Unknown" gene 1..2820 /gene="AGO3" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 7 mRNAs, 7 Proteins, and 99% coverage of the annotated genomic feature by RNAseq alignments, including 9 samples with support for all annotated introns" /db_xref="GeneID:120593272" CDS 136..2577 /gene="AGO3" /codon_start=1 /product="protein argonaute-3 isoform X2" /protein_id="XP_039706956.1" /db_xref="GeneID:120593272" /translation="
MMESKDLVPECRKWWLREVVDSMVQHFKVTIFGDCRPVYDGKRSLYTANPLPVATTGVDLDVTLPGEGGKDRPFKVSIKFVSRVSWHLLHEVLTGRTLPEPLELDKPISTNPVHAVDVVLRHLPSMKYTPVGRSFFSAPEGYDHPLGGGREVWFGFHQSVRPAMWKMMLNIDVSATAFYKAQPVIQFMCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFNADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
misc_feature 211..495 /gene="AGO3" /note="N-terminal domain of argonaute; Region: ArgoN; pfam16486" /db_xref="CDD:435368" misc_feature 523..675 /gene="AGO3" /note="Argonaute linker 1 domain; Region: ArgoL1; pfam08699" /db_xref="CDD:430160" misc_feature 676..1038 /gene="AGO3" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(832..834,877..879,919..921,931..933,985..987, 1006..1008,1012..1014) /gene="AGO3" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 1171..2448 /gene="AGO3" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1582..1584,1594..1596,1630..1641,1648..1650, 1672..1674,1681..1683,1693..1695,1705..1707) /gene="AGO3" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1786..1788,1792..1794,2002..2004,2416..2418) /gene="AGO3" /note="active site" /db_xref="CDD:240015" ORIGIN
ctctatgggcaaacccattaaattactggctaactgttttcaagttgaaattccaaagattgatgtctacctttatgaggtagatattaaaccagacaagtgtcctagaagagtgaacagtctgtgcaccagagcatgatggagtcaaaagacttggtaccagaatgtaggaagtggtggttgagggaggtggttgactcaatggttcaacattttaaagtaactatatttggggactgtagaccagtttatgatggaaaaagaagcctttacacagccaatccacttcctgtggcaactactggggtagatttagatgttactttacctggggaaggtggaaaagatcgaccttttaaggtgtcaatcaaatttgtctctcgggtgagttggcacctactacatgaagtcctgacaggacgtaccttgcctgagccactggaattagacaagccaatcagcactaatcctgtccatgctgtcgatgtggtgctacgacatctgccctccatgaaatacacgcctgtggggcgttcctttttctcagctccagaaggatatgaccaccctcttggaggaggcagggaagtatggtttggattccatcaatctgttcggcctgccatgtggaaaatgatgcttaatattgatgtttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgacattcataatattgatgagcaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaaaggtctgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaagaaggcctgccagtcatcaaacctttcctttacagttagaaaatggccaaactgtggagagaacagtagcacaatatttcagagaaaagtatactcttcagctgaagtacccacaccttccctgtctgcaagtggggcaggagcagaaacatacgtatctgccactagaagtctgtaatattgtggcagggcaacgatgtatcaagaagctaaccgacaatcagacttccactatgatcaaagcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacagatccatttgttcaggagtttcaatttaaagttcgggatgaaatggcccatgtaaccggacgcgtacttccagcacctatgctccagtatggaggacggaatcgtacagtagcaacaccaagccatggagtatgggacatgcgaggaaaacagttccacacaggagttgaaatcaaaatgtgggctatagcttgttttgccacacagaggcagtgcagagaagaaatattgaagggtttcacggaccagctgcgtaagatttctaaagatgcggggatgcccatccagggccagccttgcttctgcaaatatgcgcagggggcagacagcgtggagcccatgttccggcatctcaagaacacatactctgggctgcagctcattattgtcatcctgccagggaagacgcccgtgtatgcggaggtgaaacgtgtaggagatacacttttgggtatggctacacagtgtgttcaagtcaagaatgtaataaaaacatcccctcaaactctctcaaacctgtgcctaaagataaatgttaaactcggagggatcaataatattcttgtacctcatcaaagaccatctgtgttccagcaaccagtgatctttttgggagcagatgtcactcatccaccagctggtgatgggaagaagccttctattgctgctgttgtaggtagtatggacgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggacttggcctccatggtccgagaacttctcattcaattttataagtcaactcggttcaaacctactcgtatcatcttttatcgggatggtgtttcagagggacagtttcggcaggtgttatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagattatcaacctggaataacttacattgtagttcagaagagacatcacactcgattattttgtgctgacaggacagaaagggttggaaggagtggcaatatcccagctggaacaacagttgatacagacattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagccgtccttcacactatcatgttttatgggatgataactgctttaatgcagatgaacttcagctgctaacttaccagctctgccacacttatgtgcgctgtacacgatctgtttctatacctgcaccagcgtattatgctcacctggtggcattcagagccagatatcatctcgtagacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaaaagtccaagattattctctgagaggaagaactgaaagatgaatcgacatacaacgtgtttccagtggagttcgttgagtggggatgcctgcagccatacagaaaccaacactgtggggaccagggtctgatttttatgttgatacaagtaagattgtttacttcatcaaggaacacagcactattatgcaatatgaaaccagccaacagcgcttttgtgcggtctcctgtaggaagtatcgc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]