LOCUS       XM_039848855            3381 bp    mRNA    linear   MAM 02-MAR-2021
DEFINITION  PREDICTED: Pteropus giganteus nuclear factor kappa B subunit 1
            (NFKB1), transcript variant X2, mRNA.
ACCESSION   XM_039848855
VERSION     XM_039848855.1
DBLINK      BioProject: PRJNA703023
KEYWORDS    RefSeq.
SOURCE      Pteropus giganteus (Indian flying fox)
  ORGANISM  Pteropus giganteus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Megachiroptera;
            Pteropodidae; Pteropodinae; Pteropus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024352786.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pteropus giganteus Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3381
                     /organism="Pteropus giganteus"
                     /mol_type="mRNA"
                     /isolation_source="ENVO:00010625"
                     /db_xref="taxon:143291"
                     /chromosome="Unknown"
     gene            1..3381
                     /gene="NFKB1"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 8 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 103 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:120591230"
     CDS             136..3048
                     /gene="NFKB1"
                     /codon_start=1
                     /product="nuclear factor NF-kappa-B p105 subunit isoform
                     X2"
                     /protein_id="XP_039704789.1"
                     /db_xref="GeneID:120591230"
                     /translation="

MAEDDPYLGGHEQMFHLDPLNHTIFNPELFQPQMPLQTDGPYLQILEQPKQRGFRFRYVCEGPSHGGLPGASSEKNKKSYPQVKICNYVGPAKVIVQLVTNGKNIHLHAHSLVGKHCEDGICTVTAGPKDMVVGFANLGILHVTKKKVFETLEARMTEACIRGYNPGLLVHPDLAYLQAEGGGDRQLTDREKEIIRQAALQQTKEMDLSVVRLMFTAFLPDSTGSFTRRLEPVVSDAIYDSKAPNASNLKIVRMDRTAGCVTGGEEIYLLCDKVQKDDIQIRFYEEEENGGIWEGFGDFSPTDVHRQFAIVFKTPKYKDINITKPASVFVQLRRKSDLETSEPKPFLYYPEIKDKEEVQRKRQKLMPNFSDSFGGGGGAGAGGGGMYGSGGGGGGAGSTGPGYGFPHYGFPTYGGITFHPGTTKSNAGMKHGTIDTSSKNDPEYCDKSDDRKAVNLSGKVTETTEQDKESGNWGDEAALTYTVGVKEENARFQDNLFLEKAVQLAKRHANALFDYAVTGDVKMLLAVQRHLTTVQDENGDSVLHLAIIHLHAQLVRDLLEVTSGLISDDIINMRNDLYQTPLHLAVITKQEAVVEDLLRAGADLSLLDRLGNSVLHLAAKEGHDKILGILLKHKRTALLIDHPNGEGLNAIHIAVMSNSMQCLLLLVAAGADVNAQERKAGHTALHLAVERDNISLAGCLLLEGDAHVDSTTYDGTTPLHIAAGRGSTRLAALLKAAGADPLVENFEPLYDLDDSWEKDGEDEGVIPGTTPLDMATNWQVFDILNGKPYEPEFTSDDLLAQGDMKQLTEDAKLQLYKLLEFPDPDKNWATLAQKLGLGILNNAFRLSPAPSKTLMDNYEVSGGTIRELVEALRQMGYTEAIEVIQAAFSTSGTAAPSPVKTSQVHLLPLSPASTRQQIDELQDDSICDSGVETSFRKLSFTESLTSSSSLLTLNKMPHDYGQDGPIEGKI"

     misc_feature    256..861
                     /gene="NFKB1"
                     /note="N-terminal sub-domain of the Rel homology domain
                     (RHD) of nuclear factor of kappa B1 (NF-kappa B1); Region:
                     RHD-n_NFkB1; cd07935"
                     /db_xref="CDD:143651"
     misc_feature    order(298..300,304..309,313..318,325..336,559..561,
                     565..570,859..861)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:143651"
     misc_feature    880..1185
                     /gene="NFKB1"
                     /note="IPT domain of the transcription factor NFkappaB and
                     related transcription factors. NFkappaB is considered a
                     central regulator of stress responses, activated by
                     different stressful conditions, including physical stress,
                     oxidative stress, and exposure to...; Region:
                     IPT_NFkappaB; cd01177"
                     /db_xref="CDD:238582"
     misc_feature    order(883..885,889..897,901..909,1027..1035,1072..1074,
                     1108..1110,1165..1167,1174..1176,1180..1182)
                     /gene="NFKB1"
                     /note="ankyrin protein binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238582"
     misc_feature    order(889..894,898..900,937..939,943..945,949..951,
                     1048..1053,1060..1062,1066..1068)
                     /gene="NFKB1"
                     /note="dimerization interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238582"
     misc_feature    order(952..954,958..960,1051..1056)
                     /gene="NFKB1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238582"
     misc_feature    order(1747..1749,1753..1755,1765..1770,1777..1785,
                     1789..1794,1804..1806,1813..1815,1858..1860,1864..1866,
                     1870..1872,1882..1887,1894..1902,1906..1911,1921..1923,
                     1930..1932,1957..1959,1963..1965,1969..1971,1981..1986,
                     1993..2001,2005..2010,2020..2022,2029..2031)
                     /gene="NFKB1"
                     /note="oligomer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:293786"
     misc_feature    1747..1860
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    1786..2253
                     /gene="NFKB1"
                     /note="Ankyrin repeat [Signal transduction mechanisms];
                     Region: ANKYR; COG0666"
                     /db_xref="CDD:223738"
     misc_feature    1864..1959
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2071..2163
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2173..2271
                     /gene="NFKB1"
                     /note="ANK repeat [structural motif]; Region: ANK repeat"
                     /db_xref="CDD:293786"
     misc_feature    2569..2793
                     /gene="NFKB1"
                     /note="Death domain of the Nuclear Factor-KappaB1
                     precursor protein p105; Region: Death_NFkB1_p105; cd08797"
                     /db_xref="CDD:260063"
ORIGIN      

gatcagacccgcgcccggacctgccccgaccgggccggccgccgccgcctccttccccggcccccaggcccgcgccgccccgcagagggagccgcggcgcacggacaccgaacgcggtcgccgccaggctccagaatggcagaagacgatccgtatttgggaggccatgaacaaatgtttcatttggatcctttgaatcatacaatatttaatccagaattatttcaaccacagatgccactgcagacggatggcccatatcttcaaatattagagcaacctaaacagagaggatttcgtttccgctatgtctgtgaaggcccatctcatggtggactccctggtgcatctagtgagaagaacaagaagtcctaccctcaagtcaaaatctgcaactatgtgggacctgcaaaggttattgttcagttggtcacaaatggaaaaaacatccacctgcatgcacacagcctggtggggaaacattgtgaggatgggatctgcactgtgactgctggacccaaggacatggtggtcggctttgcaaacctgggtatacttcatgtgacaaagaaaaaagtattcgaaacactggaagcacgaatgacagaggcatgtattaggggctacaatcctggacttctggtacatcctgatcttgcctacttgcaagcagaaggtggaggagaccggcagctcactgatcgggaaaaggagattatccgccaggcagctcttcagcagacaaaggagatggacctcagcgtggtgcggctcatgtttacagcttttcttccagacagcaccggcagcttcacaaggcgcctggaacccgtagtgtcagatgccatctacgacagcaaagcccccaacgcgtccaacttgaaaattgtaagaatggacaggacagctggatgcgtaactggaggagaagagatttatcttctctgtgacaaggttcagaaagatgacatccagattcgattttatgaagaggaagaaaatggtggaatctgggaaggatttggagatttttcccccacagacgttcatagacaatttgccatcgtcttcaaaactccaaagtataaagatatcaacattacaaaaccagcctccgtgttcgtccaactacggaggaaatctgatttggaaaccagtgaaccaaaaccttttctctactaccctgaaatcaaagataaagaggaagtgcagaggaagcggcagaagctcatgcccaatttctcagatagttttggcggcggcggtggtgccggggctggaggcggaggcatgtatggcagtggcggtggaggagggggtgctggaagcacgggtccaggatatggcttccctcactatggctttcctacatatggaggaattaccttccatcctggaaccactaaatctaatgctggaatgaagcatggaaccatagacacctcatctaaaaatgaccctgaatactgtgacaagagtgatgacagaaaggctgtaaatctctctgggaaagtaaccgaaaccacagagcaagataaggagtccggcaattggggtgatgaggctgctctgacgtatacagtgggagtaaaggaagagaacgctaggtttcaggataacctctttctagagaaggctgtgcagcttgccaagcggcatgccaatgccctatttgactacgcagtgacaggagatgtgaagatgctgctggctgtccagcgccatctcactacagtgcaggatgagaatggagacagtgtcttacacttagcaatcatccaccttcatgctcaacttgtgagggatctgctagaagtcacatctggtttgatttccgatgacattatcaacatgagaaatgacctctaccagacgccgttgcacttagcagtaatcaccaaacaggaagctgtggtggaagacttactgagggccggggctgacctgagccttctggaccgcttgggtaactctgttctgcacctagctgccaaagaaggacatgataaaattctcggtattttactcaagcataaaaggacagcactacttatcgaccatcccaatggggaaggtctgaacgccattcatatagccgtgatgagcaacagcatgcagtgtctgctgctgctggtggccgcaggggcagacgtcaacgcccaggagcggaaggcagggcacacggcgctgcacctggctgtggagcgcgacaacatctccttggccggctgcctgcttctggagggtgatgcccatgtagacagtaccacctatgatggaactacaccccttcacatagcggccggaagagggtccaccaggctggcagctcttctcaaagcagcaggagcagatcccctggtagagaactttgagcctctctatgacctggacgactcttgggaaaaagatggagaggatgaaggagtcattcctggaaccacacctctagatatggccaccaactggcaggtattcgacatattaaatgggaaaccatatgagccagagtttacatctgatgatttactggcacaaggagacatgaaacagctgaccgaagatgccaagttgcagctctacaagttgctagaatttcctgatccagacaaaaactgggctactcttgcacagaaattaggtctgggaatactcaataatgccttccggctgagtcccgctccctctaaaactctcatggacaactacgaggtctctgggggcacaataagagagctggtagaggccctcagacagatgggctatactgaagccattgaagtgatccaggcggccttcagcacctcaggaactgcagcccccagcccagtgaagacctcccaggtccacctgctgcctctctcacctgcctccacaagacagcaaatagatgagctccaggacgacagcatctgtgacagcggcgtggagacatccttccgcaaactcagctttacagagtctctgaccagcagcagctcattgctaactcttaacaaaatgccccacgattatgggcaggatggacctatagaaggcaaaatctagccttctggcaattcccaacctgtaaaccaaagttctgaaattccgtggtattgtccaaaagagggtaaagtgcatccatccagtggtgcttggaggaaaacctgccagcctgaatcgctcttgatttaactcaaagcctttgaaacgtggtttcctttcttgattcttaaatgaatttcagttcggctcacttgcagatagtatctagccgtcacagccttcggcaaggctggtgcttcgttgggggtgagataacttgttgagctttactagctgctttctgttgtcattgctgccatccctctgctgctgtcattaaagagtctcacggtc

//