GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 06:31:47, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_039684340            3845 bp    mRNA    linear   VRT 22-FEB-2021
DEFINITION  PREDICTED: Pimephales promelas NRDE-2, necessary for RNA
            interference, domain containing (nrde2), transcript variant X3,
            mRNA.
ACCESSION   XM_039684340
VERSION     XM_039684340.1
DBLINK      BioProject: PRJNA702526
KEYWORDS    RefSeq.
SOURCE      Pimephales promelas (fathead minnow)
  ORGANISM  Pimephales promelas
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Leuciscidae; Pogonichthyinae; Pimephales.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024121099.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pimephales promelas Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3845
                     /organism="Pimephales promelas"
                     /mol_type="mRNA"
                     /strain="EPAAWBERC"
                     /isolation_source="USEPA AWBERC Colony"
                     /db_xref="taxon:90988"
                     /chromosome="Unknown"
     gene            1..3845
                     /gene="nrde2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 ESTs, 6 Proteins, and 100%
                     coverage of the annotated genomic feature by RNAseq
                     alignments, including 5 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:120487778"
     CDS             226..3681
                     /gene="nrde2"
                     /codon_start=1
                     /product="nuclear exosome regulator NRDE2 isoform X1"
                     /protein_id="XP_039540274.1"
                     /db_xref="GeneID:120487778"
                     /translation="
MALFPSCAGLSGINSSAEDRAPADLEWLRNQSFNREDALKTHQRATDRAQAEEPASSSEQKWKEREDSHGRSKKRKKKKKKKLKKRSRDNSESSGSESDTIYPSDLLKKDNADREEAQVRVSETFMWLDDLQTPTDSPFCIDRRADRANWEYKSLYRGDIARYRRKGDSCLGLDFRMQDVDWADKGPKKKRVVKKPERYFCPSTLQLLRADSLPALPLLSDGTAATSDSYIKLPAGTEEQGSSIQAPVSWVNPLGIYDPGTSLWLEGKGQPEVKGDQQGIKVQGGSSTLLSTRVEEFNRKLRENPTDIQLWLDFVHFQDELAFGSGSFSADSDGDIDMRKMSIRAVLEKKLSIVDRAVESNSANVDLKLKKLCLCKELWEPAVLLKEWKKLVFVHPNSVPLWRKYLLFTQSHFSTFSVSKVNSVFGKCLSTLSAVQDGSMVSHPPLPGTQEGLLDIFLQQCHFLRQAGHTEKAVCLFQALLDFTFFKPDSVKDLPTRQQVEFFEPFWDSGEPRIGERGARGWNAWMLQQERGGWVIPPEPDDDDDEEQEESEIKDKTRPKWKIWLDVETSREANNWLPWRPDKTKGQTEEDCEDPDRQVLFDDIGPSVIRVDRPDLQLQVILSFLQFLGLPGPSGRFSTTSSSNILLDDLTFLEEGPDQERPLTSYDLPLAGICAVGHMTFLSDCRRQAGLCKAGEEFLQNVLQQILLLVSAQDQATITLCWLQYEKLKVLRCLRSGNKRQLKSQGKRSKRLAKRLLKEPNNRGSLALWREYAHLEWLLGNLEEARNVFDTALGMGVSRGLSDPVLCNLCFLYAQLEVEQSLSSGTVSTSSKAVYILTKLAEGAAYTPFSGQINPVAILKARKTYEQALLSFLPEQSTDSDAEAPKKHRRTSSLVGCFGLFQYLTMGIDAADAVYKHAIQKLIPTTLNSEVTDGSLRRCKVFADWESVAVQHVALLRHHTNTNVVPLSRLRLALTDAISLLPSSPLLWHLYLQTENRYHSAGRARRFFHSVAKKTDSVVPYLFAITAERRLKQLLDSQRSHHPGEALPGQSVIGLSNRIRCLFETATATEHGAHCPLLWRMYLNFMVCDGTAESGSGIFYKALQEVPWVKGLYMDAVQLFPERVQEFLDLMTEKELRLRVPMEEVDILLEE"
     misc_feature    637..927
                     /gene="nrde2"
                     /note="MTR4-interacting domain (MID) found in nuclear
                     exosome regulator NRDE2 and similar proteins; Region:
                     NRDE2_MID; cd22200"
                     /db_xref="CDD:412062"
     misc_feature    order(637..663,670..675,685..690,694..696,700..744,
                     751..759,763..771,793..801,811..816,820..825,832..852,
                     871..882,901..927)
                     /gene="nrde2"
                     /note="MTR4 binding site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:412062"
     misc_feature    1111..2112
                     /gene="nrde2"
                     /note="necessary for RNA interference; Region: NRDE-2;
                     pfam08424"
                     /db_xref="CDD:400637"
ORIGIN      
aaccggcgggccaacaaatccttcggttagacaagagagggctgattcaatttctctcccgggatcagatctcataaactcgccgtccgtgagcgtacctttacttcaagaaacttaaggtttaattgagttttcctaaaccgattcgcataaacgagtcggactacgagtcgcagacggatgacgcaatcgtcacgcgtctgttttgaacttgaatgaagcaacatggctctgtttccgtcctgcgctggactgtcaggcattaacagctctgctgaggatagagctccagcagatctggaatggctgcgtaatcagagcttcaacagagaagatgctttgaagactcaccagcgtgccacagacagagcgcaagcagaggaaccagcaagctcaagtgagcagaagtggaaagagagagaagatagccatggcagatcgaagaagagaaagaaaaagaagaagaaaaaactcaagaagaggagcagagacaattctgagagcagtggttctgaatccgacaccatttaccccagcgacctgctaaaaaaggacaatgccgacagagaggaagctcaggttcgggtgagcgagacctttatgtggctggatgacctccagacccccactgactcccccttctgtatcgacaggagagccgaccgtgccaactgggaatacaaatccctttatagaggagacatagccaggtataggaggaagggagactcatgcctaggtttggactttaggatgcaggatgtagactgggccgacaaaggcccaaagaagaagcgggtggtcaagaaaccagagcgctatttctgtccttccacccttcagttgctccgggcagatagtctgccagctttgcccttactctctgacggcactgccgccacctctgattcctacatcaagctcccagccggcactgaagagcagggctcttccatccaggcacctgtatcatgggtcaatccgctcggcatctatgaccctggaacctctctgtggttggagggcaagggtcaaccggaggtcaagggagatcagcagggcattaaggttcaaggaggcagcagcacccttttgagcacacgggtggaggagtttaacaggaagctgcgagagaatcctacagacatccagttgtggctggactttgtacacttccaggatgagctggccttcggttctgggtctttctctgctgacagtgacggcgacattgacatgagaaagatgtctattcgtgctgtgctggagaagaagctctccatagtggacagggcggtggaaagtaactctgccaacgtggacctgaaactgaagaaactctgcttgtgcaaggagctatgggagcctgccgtcctgctgaaagagtggaagaaactagtgtttgtccatccaaatagtgtccctttatggaggaagtacctcctcttcacacagagtcatttcagcactttctcagtgtcaaaggtcaacagcgtttttggaaaatgtctgagcacgctcagtgcagtccaggatggcagtatggtgtcgcaccctccacttccaggcacacaggaaggcctcttggatatcttcctacagcagtgccatttcctgcggcaagcaggtcacacagagaaagctgtgtgtctcttccaagccctgctggacttcactttcttcaagccagacagtgtgaaagatctgcccactagacagcaggtggaattttttgagccattttgggacagtggagagcccaggataggggagcgaggggctcggggatggaatgcttggatgcttcagcaggagagaggaggatgggtgattccacctgagccagatgatgatgatgacgaagagcaggaggagtcagagatcaaagacaaaaccagacctaaatggaagatctggttagatgtagagacgtcccgtgaggcaaacaactggttgccatggagaccagataaaaccaagggccaaacagaagaggactgcgaagatcccgacaggcaggtattgtttgatgatatcggcccatctgtgattcgtgtggacagaccggatctccagctgcaggtgatcctgtcattcctgcagttcctaggtctgcctggaccttcgggaaggttttctacaacctcttcctcaaacattctactggatgatctcaccttccttgaagagggcccagaccaggagcgacctctgacctcttatgacctcccactggctgggatctgtgcagtgggtcacatgacatttctgagtgactgcaggaggcaggctgggctgtgtaaggcaggggaggagtttctccagaacgttctacagcaaattctcctgctcgtttctgcacaggatcaagctactattactctctgctggctgcagtacgagaaactcaaggtgctgagatgtttacgcagtggaaataaaaggcaactgaagtctcagggaaagcgtagtaaacgactagcgaagcggctgctaaaagagcccaataacaggggaagtctggcactttggagagagtatgcccatctagagtggcttctgggtaacctggaagaggcacgcaacgtatttgacactgccttgggcatgggtgtatctagaggtcttagtgaccctgttctctgcaacctctgctttctctatgcccaattagaggtagagcagtccttaagtagtgggacagtctcgacttcctccaaagctgtctacattctcactaaattagccgagggtgctgcttacactcctttctctggacagatcaacccagtggccatattgaaggccaggaagacctatgagcaggcactgttgagctttttacctgagcagagcacagacagcgatgctgaagctcccaagaaacaccgcaggacatccagcctggttggatgctttggactttttcagtacctgacaatggggattgatgcagctgatgccgtatacaaacatgccatccaaaaactgattcccaccaccttgaattcagaagtgacagatggttctctgaggagatgcaaggtctttgctgactgggaatctgttgctgtccagcatgtagcactgctacgccaccacaccaacaccaatgtggttcctctttcccgactaagactggcacttacagatgccatctccttacttccctccagccccttgttatggcatctctacctgcaaacagaaaatcgctatcacagcgcaggccgtgcccgaaggtttttccacagtgtggcaaagaaaactgacagtgttgtgccttatctattcgccatcactgcagaacgacgactcaaacagcttctggactcgcagaggtctcatcatcctggagaagctctccccggccagtcagtgattggtcttagcaaccgtatccgctgtctgtttgaaactgctacagcaacagaacatggggcccattgtcctctgctgtggagaatgtatctgaacttcatggtgtgtgatgggactgcagagagtggcagtggaatcttctacaaggctctgcaggaagttccctgggtaaagggcttgtacatggacgccgtgcagctgtttcctgaacgtgtgcaagagtttttagatcttatgactgagaaggagttgcgtctgagagtgcccatggaggaggtggacatcttgctggaggagtagccatccaaacccttaccacaatacactagaaatcagttaccgctgaccaccaaccaaccaccagatcaatctctgaaaaaaaactacagattttatttatttttatgcattgttaaatgtatttttccatgatttggggaataaatgattacgtttgaagtttt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]