2025-10-17 04:58:20, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XM_039684276 3826 bp mRNA linear VRT 22-FEB-2021 DEFINITION PREDICTED: Pimephales promelas NRDE-2, necessary for RNA interference, domain containing (nrde2), transcript variant X2, mRNA. ACCESSION XM_039684276 VERSION XM_039684276.1 DBLINK BioProject: PRJNA702526 KEYWORDS RefSeq. SOURCE Pimephales promelas (fathead minnow) ORGANISM Pimephales promelas Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Leuciscidae; Pogonichthyinae; Pimephales. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_024121099.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Pimephales promelas Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3826 /organism="Pimephales promelas" /mol_type="mRNA" /strain="EPAAWBERC" /isolation_source="USEPA AWBERC Colony" /db_xref="taxon:90988" /chromosome="Unknown" gene 1..3826 /gene="nrde2" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 ESTs, 6 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 7 samples with support for all annotated introns" /db_xref="GeneID:120487778" CDS 207..3662 /gene="nrde2" /codon_start=1 /product="nuclear exosome regulator NRDE2 isoform X1" /protein_id="XP_039540210.1" /db_xref="GeneID:120487778" /translation="
MALFPSCAGLSGINSSAEDRAPADLEWLRNQSFNREDALKTHQRATDRAQAEEPASSSEQKWKEREDSHGRSKKRKKKKKKKLKKRSRDNSESSGSESDTIYPSDLLKKDNADREEAQVRVSETFMWLDDLQTPTDSPFCIDRRADRANWEYKSLYRGDIARYRRKGDSCLGLDFRMQDVDWADKGPKKKRVVKKPERYFCPSTLQLLRADSLPALPLLSDGTAATSDSYIKLPAGTEEQGSSIQAPVSWVNPLGIYDPGTSLWLEGKGQPEVKGDQQGIKVQGGSSTLLSTRVEEFNRKLRENPTDIQLWLDFVHFQDELAFGSGSFSADSDGDIDMRKMSIRAVLEKKLSIVDRAVESNSANVDLKLKKLCLCKELWEPAVLLKEWKKLVFVHPNSVPLWRKYLLFTQSHFSTFSVSKVNSVFGKCLSTLSAVQDGSMVSHPPLPGTQEGLLDIFLQQCHFLRQAGHTEKAVCLFQALLDFTFFKPDSVKDLPTRQQVEFFEPFWDSGEPRIGERGARGWNAWMLQQERGGWVIPPEPDDDDDEEQEESEIKDKTRPKWKIWLDVETSREANNWLPWRPDKTKGQTEEDCEDPDRQVLFDDIGPSVIRVDRPDLQLQVILSFLQFLGLPGPSGRFSTTSSSNILLDDLTFLEEGPDQERPLTSYDLPLAGICAVGHMTFLSDCRRQAGLCKAGEEFLQNVLQQILLLVSAQDQATITLCWLQYEKLKVLRCLRSGNKRQLKSQGKRSKRLAKRLLKEPNNRGSLALWREYAHLEWLLGNLEEARNVFDTALGMGVSRGLSDPVLCNLCFLYAQLEVEQSLSSGTVSTSSKAVYILTKLAEGAAYTPFSGQINPVAILKARKTYEQALLSFLPEQSTDSDAEAPKKHRRTSSLVGCFGLFQYLTMGIDAADAVYKHAIQKLIPTTLNSEVTDGSLRRCKVFADWESVAVQHVALLRHHTNTNVVPLSRLRLALTDAISLLPSSPLLWHLYLQTENRYHSAGRARRFFHSVAKKTDSVVPYLFAITAERRLKQLLDSQRSHHPGEALPGQSVIGLSNRIRCLFETATATEHGAHCPLLWRMYLNFMVCDGTAESGSGIFYKALQEVPWVKGLYMDAVQLFPERVQEFLDLMTEKELRLRVPMEEVDILLEE"
misc_feature 618..908 /gene="nrde2" /note="MTR4-interacting domain (MID) found in nuclear exosome regulator NRDE2 and similar proteins; Region: NRDE2_MID; cd22200" /db_xref="CDD:412062" misc_feature order(618..644,651..656,666..671,675..677,681..725, 732..740,744..752,774..782,792..797,801..806,813..833, 852..863,882..908) /gene="nrde2" /note="MTR4 binding site [polypeptide binding]; other site" /db_xref="CDD:412062" misc_feature 1092..2093 /gene="nrde2" /note="necessary for RNA interference; Region: NRDE-2; pfam08424" /db_xref="CDD:462472" ORIGIN
aaccggcgggccaacaaatccttcggttagacaagagagggctgattcaatttctctcccgggatcagatctcataaactcgccgtccgtgagcgtacctttacttcaagaaacttaagaaccgattcgcataaacgagtcggactacgagtcgcagacggatgacgcaatcgtcacgcgtctgttttgaacttgaatgaagcaacatggctctgtttccgtcctgcgctggactgtcaggcattaacagctctgctgaggatagagctccagcagatctggaatggctgcgtaatcagagcttcaacagagaagatgctttgaagactcaccagcgtgccacagacagagcgcaagcagaggaaccagcaagctcaagtgagcagaagtggaaagagagagaagatagccatggcagatcgaagaagagaaagaaaaagaagaagaaaaaactcaagaagaggagcagagacaattctgagagcagtggttctgaatccgacaccatttaccccagcgacctgctaaaaaaggacaatgccgacagagaggaagctcaggttcgggtgagcgagacctttatgtggctggatgacctccagacccccactgactcccccttctgtatcgacaggagagccgaccgtgccaactgggaatacaaatccctttatagaggagacatagccaggtataggaggaagggagactcatgcctaggtttggactttaggatgcaggatgtagactgggccgacaaaggcccaaagaagaagcgggtggtcaagaaaccagagcgctatttctgtccttccacccttcagttgctccgggcagatagtctgccagctttgcccttactctctgacggcactgccgccacctctgattcctacatcaagctcccagccggcactgaagagcagggctcttccatccaggcacctgtatcatgggtcaatccgctcggcatctatgaccctggaacctctctgtggttggagggcaagggtcaaccggaggtcaagggagatcagcagggcattaaggttcaaggaggcagcagcacccttttgagcacacgggtggaggagtttaacaggaagctgcgagagaatcctacagacatccagttgtggctggactttgtacacttccaggatgagctggccttcggttctgggtctttctctgctgacagtgacggcgacattgacatgagaaagatgtctattcgtgctgtgctggagaagaagctctccatagtggacagggcggtggaaagtaactctgccaacgtggacctgaaactgaagaaactctgcttgtgcaaggagctatgggagcctgccgtcctgctgaaagagtggaagaaactagtgtttgtccatccaaatagtgtccctttatggaggaagtacctcctcttcacacagagtcatttcagcactttctcagtgtcaaaggtcaacagcgtttttggaaaatgtctgagcacgctcagtgcagtccaggatggcagtatggtgtcgcaccctccacttccaggcacacaggaaggcctcttggatatcttcctacagcagtgccatttcctgcggcaagcaggtcacacagagaaagctgtgtgtctcttccaagccctgctggacttcactttcttcaagccagacagtgtgaaagatctgcccactagacagcaggtggaattttttgagccattttgggacagtggagagcccaggataggggagcgaggggctcggggatggaatgcttggatgcttcagcaggagagaggaggatgggtgattccacctgagccagatgatgatgatgacgaagagcaggaggagtcagagatcaaagacaaaaccagacctaaatggaagatctggttagatgtagagacgtcccgtgaggcaaacaactggttgccatggagaccagataaaaccaagggccaaacagaagaggactgcgaagatcccgacaggcaggtattgtttgatgatatcggcccatctgtgattcgtgtggacagaccggatctccagctgcaggtgatcctgtcattcctgcagttcctaggtctgcctggaccttcgggaaggttttctacaacctcttcctcaaacattctactggatgatctcaccttccttgaagagggcccagaccaggagcgacctctgacctcttatgacctcccactggctgggatctgtgcagtgggtcacatgacatttctgagtgactgcaggaggcaggctgggctgtgtaaggcaggggaggagtttctccagaacgttctacagcaaattctcctgctcgtttctgcacaggatcaagctactattactctctgctggctgcagtacgagaaactcaaggtgctgagatgtttacgcagtggaaataaaaggcaactgaagtctcagggaaagcgtagtaaacgactagcgaagcggctgctaaaagagcccaataacaggggaagtctggcactttggagagagtatgcccatctagagtggcttctgggtaacctggaagaggcacgcaacgtatttgacactgccttgggcatgggtgtatctagaggtcttagtgaccctgttctctgcaacctctgctttctctatgcccaattagaggtagagcagtccttaagtagtgggacagtctcgacttcctccaaagctgtctacattctcactaaattagccgagggtgctgcttacactcctttctctggacagatcaacccagtggccatattgaaggccaggaagacctatgagcaggcactgttgagctttttacctgagcagagcacagacagcgatgctgaagctcccaagaaacaccgcaggacatccagcctggttggatgctttggactttttcagtacctgacaatggggattgatgcagctgatgccgtatacaaacatgccatccaaaaactgattcccaccaccttgaattcagaagtgacagatggttctctgaggagatgcaaggtctttgctgactgggaatctgttgctgtccagcatgtagcactgctacgccaccacaccaacaccaatgtggttcctctttcccgactaagactggcacttacagatgccatctccttacttccctccagccccttgttatggcatctctacctgcaaacagaaaatcgctatcacagcgcaggccgtgcccgaaggtttttccacagtgtggcaaagaaaactgacagtgttgtgccttatctattcgccatcactgcagaacgacgactcaaacagcttctggactcgcagaggtctcatcatcctggagaagctctccccggccagtcagtgattggtcttagcaaccgtatccgctgtctgtttgaaactgctacagcaacagaacatggggcccattgtcctctgctgtggagaatgtatctgaacttcatggtgtgtgatgggactgcagagagtggcagtggaatcttctacaaggctctgcaggaagttccctgggtaaagggcttgtacatggacgccgtgcagctgtttcctgaacgtgtgcaagagtttttagatcttatgactgagaaggagttgcgtctgagagtgcccatggaggaggtggacatcttgctggaggagtagccatccaaacccttaccacaatacactagaaatcagttaccgctgaccaccaaccaaccaccagatcaatctctgaaaaaaaactacagattttatttatttttatgcattgttaaatgtatttttccatgatttggggaataaatgattacgtttgaagtttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]