LOCUS       XM_039399253             540 bp    mRNA    linear   INV 10-FEB-2021
DEFINITION  PREDICTED: Styela clava caspase-3-like (LOC120332051), mRNA.
ACCESSION   XM_039399253
VERSION     XM_039399253.1
DBLINK      BioProject: PRJNA699607
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Styela clava
  ORGANISM  Styela clava
            Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea;
            Stolidobranchia; Styelidae; Styela.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_024102830.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Styela clava Annotation Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 100% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..540
                     /organism="Styela clava"
                     /mol_type="mRNA"
                     /isolate="OUC-MLS-2016-MISD03-12-06"
                     /isolation_source="sea water"
                     /db_xref="taxon:7725"
                     /chromosome="Unknown"
                     /sex="hermaphrodite"
                     /tissue_type="whole body"
                     /dev_stage="adult"
                     /country="China: Qingdao"
                     /collection_date="2016-12"
                     /collected_by="Xiang Li"
     gene            1..540
                     /gene="LOC120332051"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 16 Proteins"
                     /db_xref="GeneID:120332051"
     CDS             1..540
                     /gene="LOC120332051"
                     /codon_start=1
                     /product="caspase-3-like"
                     /protein_id="XP_039255187.1"
                     /db_xref="GeneID:120332051"
                     /translation="

MTHGNLLKDESKKQEIEVIYGKNGGTDYIERKEIDNMFQNDVAVDLQGIPKFFIYQCCRGKIHMKAINSQIETDDIETDCSDREDAVPIISDIVIINSTLPGHMAYKDGEGSILITSINTIFGKHGKKKHVLDLLTMVNSEMLKYISSCRQSPQSLETIFIKPMSVLESCLVKHFYLTE"

     misc_feature    <1..531
                     /gene="LOC120332051"
                     /note="Caspase, interleukin-1 beta converting enzyme (ICE)
                     homologues; Cysteine-dependent aspartate-directed
                     proteases that mediate programmed cell death (apoptosis).
                     Caspases are synthesized as inactive zymogens and
                     activated by proteolysis of the peptide...; Region: CASc;
                     cl00042"
                     /db_xref="CDD:444667"
     misc_feature    order(7..9,172..174)
                     /gene="LOC120332051"
                     /note="active site"
                     /db_xref="CDD:237997"
     misc_feature    order(10..12,166..168,187..189,310..324,334..339)
                     /gene="LOC120332051"
                     /note="substrate pocket [chemical binding]; other site"
                     /db_xref="CDD:237997"
     misc_feature    order(190..192,265..270,289..291,298..300,307..309,
                     373..375,397..399,415..417,484..486,499..504,508..510,
                     517..522)
                     /gene="LOC120332051"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:237997"
     misc_feature    order(193..195,262..264)
                     /gene="LOC120332051"
                     /note="proteolytic cleavage site [active]"
                     /db_xref="CDD:237997"
ORIGIN      

atgacacacggcaatttgctcaaggacgaatctaaaaaacaagaaatagaagtcatatatgggaaaaatgggggaactgattatattgaaagaaaggagattgacaacatgttccaaaatgatgtcgccgtggatctccaggggattccaaaattttttatatatcaatgttgtcgaggaaaaattcatatgaaagcgataaattcgcagatagaaactgatgacattgaaactgattgctcagatcgagaagacgcagtacctattatcagcgacattgtcatcatcaattccacactcccaggtcacatggcgtataaagatggcgaaggttctattctgattacatcaataaacaccattttcggaaaacatggtaagaaaaaacatgtattagatttgctgacaatggtgaactctgagatgttgaaatatattagcagctgtagacaatcgcctcagtcattagagactattttcataaagccgatgtccgtattggagtcatgcttggtgaaacacttttacctgaccgaatga

//