2024-04-18 14:24:10, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_039399253 540 bp mRNA linear INV 10-FEB-2021 DEFINITION PREDICTED: Styela clava caspase-3-like (LOC120332051), mRNA. ACCESSION XM_039399253 VERSION XM_039399253.1 DBLINK BioProject: PRJNA699607 KEYWORDS RefSeq; includes ab initio. SOURCE Styela clava ORGANISM Styela clava Eukaryota; Metazoa; Chordata; Tunicata; Ascidiacea; Stolidobranchia; Styelidae; Styela. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_024102830.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Styela clava Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 100% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..540 /organism="Styela clava" /mol_type="mRNA" /isolate="OUC-MLS-2016-MISD03-12-06" /isolation_source="sea water" /db_xref="taxon:7725" /chromosome="Unknown" /sex="hermaphrodite" /tissue_type="whole body" /dev_stage="adult" /country="China: Qingdao" /collection_date="2016-12" /collected_by="Xiang Li" gene 1..540 /gene="LOC120332051" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 16 Proteins" /db_xref="GeneID:120332051" CDS 1..540 /gene="LOC120332051" /codon_start=1 /product="caspase-3-like" /protein_id="XP_039255187.1" /db_xref="GeneID:120332051" /translation="
MTHGNLLKDESKKQEIEVIYGKNGGTDYIERKEIDNMFQNDVAVDLQGIPKFFIYQCCRGKIHMKAINSQIETDDIETDCSDREDAVPIISDIVIINSTLPGHMAYKDGEGSILITSINTIFGKHGKKKHVLDLLTMVNSEMLKYISSCRQSPQSLETIFIKPMSVLESCLVKHFYLTE"
misc_feature <1..531 /gene="LOC120332051" /note="Caspase, interleukin-1 beta converting enzyme (ICE) homologues; Cysteine-dependent aspartate-directed proteases that mediate programmed cell death (apoptosis). Caspases are synthesized as inactive zymogens and activated by proteolysis of the peptide...; Region: CASc; cl00042" /db_xref="CDD:444667" misc_feature order(7..9,172..174) /gene="LOC120332051" /note="active site" /db_xref="CDD:237997" misc_feature order(10..12,166..168,187..189,310..324,334..339) /gene="LOC120332051" /note="substrate pocket [chemical binding]; other site" /db_xref="CDD:237997" misc_feature order(190..192,265..270,289..291,298..300,307..309, 373..375,397..399,415..417,484..486,499..504,508..510, 517..522) /gene="LOC120332051" /note="dimer interface [polypeptide binding]; other site" /db_xref="CDD:237997" misc_feature order(193..195,262..264) /gene="LOC120332051" /note="proteolytic cleavage site [active]" /db_xref="CDD:237997" ORIGIN
atgacacacggcaatttgctcaaggacgaatctaaaaaacaagaaatagaagtcatatatgggaaaaatgggggaactgattatattgaaagaaaggagattgacaacatgttccaaaatgatgtcgccgtggatctccaggggattccaaaattttttatatatcaatgttgtcgaggaaaaattcatatgaaagcgataaattcgcagatagaaactgatgacattgaaactgattgctcagatcgagaagacgcagtacctattatcagcgacattgtcatcatcaattccacactcccaggtcacatggcgtataaagatggcgaaggttctattctgattacatcaataaacaccattttcggaaaacatggtaagaaaaaacatgtattagatttgctgacaatggtgaactctgagatgttgaaatatattagcagctgtagacaatcgcctcagtcattagagactattttcataaagccgatgtccgtattggagtcatgcttggtgaaacacttttacctgaccgaatga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]