GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 11:50:42, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_039108541            1730 bp    mRNA    linear   ROD 21-JAN-2021
DEFINITION  PREDICTED: Rattus norvegicus uncharacterized LOC120102195
            (LOC120102195), transcript variant X1, mRNA.
ACCESSION   XM_039108541
VERSION     XM_039108541.1
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051339.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rattus norvegicus Annotation Release
                                           108
            Annotation Version          :: 108
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1730
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="4"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..1730
                     /gene="LOC120102195"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 6 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 8 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:120102195"
     CDS             591..1643
                     /gene="LOC120102195"
                     /codon_start=1
                     /product="uncharacterized protein LOC120102195 isoform X1"
                     /protein_id="XP_038964469.1"
                     /db_xref="GeneID:120102195"
                     /translation="
MAECKRLNVYTDSRYAFATAHIHGKIYRRRGLLTSEGKDIKNKTEILAFLAALFLQKRLSIIHCPGHQKGHSPEARGNRLTDISAREAAMGTQVLSLKDQDQPTSPQPEQTSWLYTTEDTKLLQKMGAVWYPQLKRWVYTGKTVMPTKMTFELISYLHKLTHLGLKKMKTLLRQEEIDTYLLGRDQALREVTESCRACAQVNPGKAKIGQGVRPRGHWPGTHWEIDFTEIKPAHLQALQIVQRDIWKPLAAAYQDRLEQPMVPHPFQIRDTVWVCRHRTKNLEPRWKGPYTVLLTTPTALKVDGIAAWIHASHVKAARPEETADHNTAPQTWKAQHTQNPLKLRFSRCCS"
     misc_feature    <591..857
                     /gene="LOC120102195"
                     /note="Ribonuclease H-like superfamily, including RNase H,
                     HI, HII, HIII, and RNase-like domain IV of spliceosomal
                     protein Prp8; Region: RNase_H_like; cl14782"
                     /db_xref="CDD:417494"
     misc_feature    933..1208
                     /gene="LOC120102195"
                     /note="His(2)-Cys(2) zinc finger; Region: zf-H2C2;
                     cl07828"
                     /db_xref="CDD:385237"
     misc_feature    1380..1631
                     /gene="LOC120102195"
                     /note="Murine leukemia virus (MLV) integrase (IN)
                     C-terminal domain; Region: MLVIN_C; pfam18697"
                     /db_xref="CDD:408474"
ORIGIN      
tgtatgctaagggggtcctaacacaaagactgggaccctggaagcgcctggtagcctacctgtctaagaaattagaccctgtggcctccggttggccaccatgcctgagaatggtggcagccattaccgtcctaaccaaagacgctgggaagttgaccttggggcagccactcaccatcctggcacctcatgcagtggaggctttgataaaacagccccctgaccactggctctctaattcccgcatgacccactaccaagccttgctactggatgcggaacgggtccagtttaggcccgtggtcgctctcaacccagccactctgcttcctttgccagaggaggcagaacagcacgactgtccgcagatccttgcagaagtacatggaaccagaccagacctatcggactgacctctccaggatgctgaccatacgtggtacaccgatggtagcagctacttggtgaacggggaacggaaagctggagccgcggtcactacggagtgcaaagtgatctgggcaagtgccttgccagctggtacctccgcacagtgggctgaactcattgccttaactcaggtgctcaaaatggcagaatgtaagaggctgaatgtatatacagacagccgctacgcctttgctacagcacacatccatggaaagatctaccggagaagagggctgctcacatctgagggcaaggacattaagaacaagactgaaattctggccttcctggcagctctgttcctacaaaaaagactgagcattatacattgcccagggcatcagaagggacacagccccgaggcacggggaaatcggctaactgacatctcagcgcgtgaggccgccatgggcacccaagttctgtccttaaaagaccaagatcaacccacgtctccacagccggaacagaccagttggctctacaccacggaggacacaaagctcctacagaaaatgggggccgtttggtacccacaactaaaacggtgggtctacacagggaaaacagttatgcctacgaagatgacctttgaattaatctcctacctacataaattaacacacctgggactcaagaagatgaagaccctcttaagacaagaagagattgacacctacctcctgggacgagatcaggccttgcgggaggtgactgaaagctgcagggcctgtgctcaggtaaacccaggaaaagctaaaattggacaaggagtccgtccccgaggacattggcctggtacccactgggaaattgacttcactgaaatcaagcctgcacatcttcaggccctacaaatcgtgcagagagacatctggaaacctctagccgcggcctaccaagacaggcttgaacaaccgatggtgccgcacccgttccagatcagagacactgtgtgggtgtgcagacatcggaccaagaatctcgagcctcggtggaaaggaccctatacagttctcctgactaccccgacagccttgaaggtagacggaattgcggcttggatccacgcgtctcacgtcaaggcagcccgacctgaggaaacggcagatcacaacaccgcgccccagacatggaaggctcaacacactcaaaaccccctaaagctaagattttcacgttgttgctcttaactgtcttatggactaggggtggggcaagtctgggggctagcccccaccaggtatataatatgtcctggataataactaatttagaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]