GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 11:29:42, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_039087257           14094 bp    mRNA    linear   ROD 21-JAN-2021
DEFINITION  PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and
            titin-interacting RhoGEF (Obscn), transcript variant X36, mRNA.
ACCESSION   XM_039087257
VERSION     XM_039087257.1
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051345.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rattus norvegicus Annotation Release
                                           108
            Annotation Version          :: 108
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..14094
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..14094
                     /gene="Obscn"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 23 ESTs, 2 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 6 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:338458"
                     /db_xref="RGD:631335"
     CDS             193..14040
                     /gene="Obscn"
                     /codon_start=1
                     /product="obscurin isoform X34"
                     /protein_id="XP_038943185.1"
                     /db_xref="GeneID:338458"
                     /db_xref="RGD:631335"
                     /translation="
MVTLRCQMSKVTPVEWRKGSETLRDGGRYSLRQDGAVCELQIHRLALEDAGEYSCLCGQEKTSATLSVKALPPRFIEDLRSQEATEGNMVTLRCQMSKVTPVEWRKGSETLRDGGRYSLRQDGAVCELQIHRLALEDAGEYSCLCGQEKTSATLSVKALPPRFTEDLRSQKATEGTMVTLRCQMSKAAPVEWRKGSETLRDGGRYSLRQDGAVYELQIRGLALEDAGEYSCVCGQEKTSATLSVKALPARFIEDLRSQEVPESSTVTMRCELSKKAPVVWRKGSETLKNGARYSLRQDGAVCELEIRDLTVEDAGEYSCTCGKERTSATLSIMAPQVVFQKLLENLQAEEGSTASLRCELSVPNTAVVWSKGGLELQADTCRETRQQGCVAELLLRDVRREDAGEYSCTCGSQTTSATLMVTAAPVRFLQELQAQDVDEGTTARLRCELSREAASVEWRKGSLQLFPCAKYQMVQEGTTAELLVHGVEQEDAGEYTCDAGHMQSIARLSVRAPKPKFKTGLQSKEQEAGGTARLCCQLSEAESGTPVQWLKEGVELHVSSKYEMRCQGAMCELLIHKLEAKDTGEYACVVGGQKTLASLRVKEPEVTIVQGLVDMEVQADEDVEFTCKVSQAGATDVQWHLQGLPLQSNEVTEVAVLGDGCTHVLQLKGVTLDDAGTVSFHVGSHSSSAQLIVRVPEVTVLEPLKDVQLSEGQDAHFQCRLSRASGQEARWALGGVPLQCNEMNDITVEQGTLYSLTLHKVTLEDAGTITLQVGSCSSEAQLKVTEAALCLVRGLQNVDVFAGEVATFSCEVSRAGGPEARWWLDGTLLQNSPESAMTVREGTVHSLTLSGLGVADSGTITFRTGPLVSTAKLLVKDPTVEVVSAMQDLVVEEGGSAELLCQYSRPVQAMWKMNEREVCADGHRVIIEQDWTVARLTLRPALPCDSGIYSCEAAGTRVVALLQVQAKNTVVRGLENVDALEGGEALFECQLSQPEVAAHTWLLDDEPVHTSANVEVVYFENGLRHLLLLKNLKPQDSCRVTFLAGDVVTSAFLTVRGWRLEVLEPPQDASVKAGTQVCFTCILSEALPVGEATWYINGAAIQPDDADWIVTADGSHHALTLSNAQPQHAGEVTFAARDAVASARLSVLALPGPPEDAEVVGRSDHSVTLSWVAPVSDGGGGLCGYRVEMKEASTGQWQLCHELVPGPECVVDGLVSGKTYRFRVAAVGPAGAGEPVHLPQMVKIAEPMEPKPAPAPAPALAPTPAPIPTPAPAPAPAPTPAPTPTPAPAPAPAPAPATRRAVVGEDVCLELEVAADAGEVVWHKGTERIHPSGHFEVLSQGQRQMLVIKGFRTEDQGEYRCGPIQGLPSSGASTFNVVVTSGSEDEVPAQPSLPPEAAQEGDLHLLWEALARKRRMSREPTLDSISELPEEDSRVQHLRQEAEEAAPDLSEGYSTADELARTGEADLSHTSSDDESRAGTPSLITYLKKAGGPGISPLASKHEAQVATSVKPQKQQERVVPTCPLPGDLNAADLKDPSLDKAAVKIQAAFKGYKVRKEMKQQGGPVFSRTFGDTEAQVGDALRLECVVSTKADVRACWLKDGVELTDGRHYHIDQLKDGTCSLLVTGLGPTDSGRYTCQVSTKFGSVSHSACVMVSGTESEAESSSGGELDDAFRRAARRLHRLFRTKSPAELSEEELFLSADEGPMEPEEPADWQTYREDENFVCIRFESLAEAHRAVTCFRDMFATMGIGVEISLGEQGPRGVEMRIGKVAPTVIPAVPLAKTPGLQTSDAAPVFLTELQNQDVQDGYPMSFDCVVTGQPVPSVRWFKDGKLLEEDDHYMINEDQQGGHQLIITAVVPADMGVYRCLAENSMGVSSTKAELRVELTSTDYDTAADATETSSYFSAQGYLSSREQEGTESDEGQLPQVLEELKDLQVAPGTRLAKFQLKVKGYPAPKLYWFKDGQPLTTSDHIRMTDKKTLHTLEIVSITREDSGQYAAYISNAVGAAYSSARLLVRGPSEPEEKPQPDVHERLVPPRILEKFTPKKVKRGSSITFSVKVEGHPAPSVHWLKEEAEKGVLWIGPDTPGYTMASSSKQHSLVLLDVGRQHQGTYTCIATNAAGQALCSASLHISGLAKEEEQERVKEALISSFLQGTSQAVSAQMSESASFADLVGQRKGESLVAEEAHSHLSLSEVGTEEFLQKLTSQITEMVSAKISQAKLQVPGGDSDEESKTPSASPRHGRSRPSSSVQESSSESEDGDSRGEIFDIYVVTADYLPLGAEQDAIILREGQYVEVLDSAHPLRWLVRTKPTKSSPSRQGWVSPAYLDKRLKLSPEWGPTEAPEFPGEAVSEDEYRTRLSSVIQELLSSEQAFVGELQFLESHHIKHLDRSPRVPAAVASQKTVIFRNVQDISHFHSSFLKELQSCGTDDDVAMCFIKNQEAFEKYLEFLVGRVQAESVVVSTPVQEFYKKYAEEMLSAKDPTQPPPPPLQHYLEQPVERVQKYQALLKELIRNKARNRQNCALLEQAYAVVSALPQRAENKLHVSLMENYPGTLEALGEPIRQGHFIVWEGAPGARMPWKGHNRHVFLFRNHLVICKPRRDSRTDTFSYVFRNMMKLNSIDLNDQVEGDDRAFEVWHEREDSVRKYLLQARTVIIKNSWVKEICGIQQRLAQPVWRPPEFEEELADCTAELGETVKLACRVTGTPKPIVSWYKDGKPVEVDPHHILIEDPDGSCTLILDNLTGIDSGQYMCFAASAAGNASTLGKILVQVPPRFVNKVRATPFVEGEDAQITCTVEGAPYPQIRWYKDGALLTLGNRYRMVNEPRSGMLVLVIQAASKEDLGHYECELVNRLGSTRCGGELYMQSPALRAWDQHHREQLVAAVEDASMEDSAHPTQEGADQQAASVLWRLLGSEALSPSPGGFPNTRQSEPPTSEEAAPQIPGTTSGTPGKLPEASRPGTYKGLEQGMTTTSGSQERNVPIRVEGTAWPGGGTGQLLLDVHSQVIMETTQRTYVCQAPDTGVTRAPSMQVTIEDLQVQVGDMAQFDAVIEGNPPPTVTWYKDSNQLVNGTRLRQQQGGTTYSLVLMDVTPHDAGVYTCVAQNAGGQVLCKAELLVYGGDKSDAEKQAYRRKLHSFYEVQEEIGRGVFGFVKRVQHKGNKMSCAAKFIPLRSKTRAQAYQERDILATLSHPLVTGLLDQFETQKTLILILELCSSEELLDRLFKKAVVTEAEVKVYIQQLVEGLHYLHSHDILHLDIKPPNILMVHPAREDIKICDFGFAQKITPSEPQYSKYGSPEFVSPEIIEQSPVSEGSDIWAMGVISYLSLTCSSPFAGESDRATLLNVLEGRVSWSSPMAAHLSEDAKDFIKATLQKTPRARPSASQCLAHPWFLKSMPAEEAHFINTKQLKFLLARSRWQRSLMSYKSILVMRSIPELLQGPPDSPSLGVARHLRGEASGSSSSSSSSDNELAPFARAKSLPPSPVTHSPLLHPRGFLRPSASLPEETEASMSTADAAMPAPPQSAGPPASPGCVPRHSVISSLFYQQAGEGAERGSKALGAKRHPARRRHLLKGGYIARALPGLREPLMEFSVLEEEAANEEQASLMTKTPSFETALRLPSSNVREVPGRSRSLDNPPGTASPSPEAYKEQYLSPPSSGLTHETTAKGMGHKEGFLQESVPFSPTSGDLRPVKQEGSSQDSCRGKPASSCHSELGSGPQEGCGSPSSQLCGSLPPQSSKKELSKPCGPLFSEQPQAAPFPAQASPLLGSQKEPQDSYLPEKPCPVPSSSPGSASQVDASLDTEGLSEAGDTCDFTPPLQRPQEQATTRKFSLESRGGYAGVAGYGTFAFGGDAGGMLGQGPLWARMAWAVSQSSEEQDEAATESPQPLDSSGPIAEASGVPLRTSPSLTPWEEVEQVSLVQIRDLSGDAEAADTISLDISEVDPAYLNLSDLYDIKYLPFEFMIFRRVPKPVEQPESPGSETEEGQGLAEFLEEAVWPWPGELGLRAGLEITEEPQEPGDLEALLGEAAVGRKRKWSPSRGLFQFPGRCLSGEEPVELGLRQRVKASMAHISRILKGKPEGPEKEGPPRKKAGLASFRLSGLKGRDQAPSFLRELSDEAVVLGQSVTLACQVLAQPTAQATWSKDGALLESSGHLLISSTLKNFQLLTILVVTEEDLGTYTCCVSNPLGTAVTTGVLRKAERPSSSPRPEVGELYTDAVLLVWKPVESYGPVTYIVQCCIEGGSWTTLASDISDCCYLTGKLPRGGMYTFRTACVSKAGMGPYSSPSEQVLLGGPNHLASEEESSRGRPAQLLPSTKTFAFQTQIRRGRFSVVRQCREKASGRALAAKIVPYQPEDKTTVLREYEALKRLHHPHLAQLHAAYLSPRHLVLILELCSGPELLPSLAERDSYSESDVKDYLWQMLSATQYLHAQHILHLDLRSENMMVTEYNLLKVIDLGNAQSLSQEKVPPPENFKDYLETMAPELLEGQGAVPQTDIWAIGVTAFIMLSGEYPVSSEGTRDLQKGLRKGLIQLSRCYAGLSGGAVAFLQSSLCARPWGRPCASTCLQCGWLTEEGPTGSRPTPVTFPTARLRAFVREREKRRALLYKKHNLAQVR"
     misc_feature    196..396
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    196..210
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    232..243
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    304..318
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    406..417
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    409..660
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    424..438
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    460..486
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    514..525
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    541..558
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    565..582
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    628..660
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    673..924
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    697..711
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    721..741
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    757..774
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    781..792
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    805..822
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    829..846
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    871..891
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    898..924
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    940..1188
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    949..969
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    988..1011
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1024..1038
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1042..1053
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1066..1080
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1093..1116
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1204..1455
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1210..1218
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    1225..1239
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    1249..1269
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1288..1305
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1312..1323
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1336..1353
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1360..1377
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1402..1422
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1429..1455
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1471..1722
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1516..1536
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1555..1572
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1579..1590
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1603..1620
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1627..1644
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1669..1689
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1696..1722
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1771..1995
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1783..1803
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1828..1845
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1852..1863
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1876..1893
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1900..1917
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1942..1962
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1969..1995
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2014..2271
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2059..2073
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2098..2112
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2173..2193
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2278..2544
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2302..2319
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    2332..2355
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2374..2394
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2395..2406
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2422..2442
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    2449..2481
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2509..2544
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2566..2781
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2575..2592
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    2605..2628
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2647..2667
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2668..2679
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2695..2715
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    2722..2754
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2851..3051
                     /gene="Obscn"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:214653"
     misc_feature    2881..2895
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2914..2928
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2992..3006
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3034..3051
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3100..3357
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3373..3633
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3388..3405
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    3418..3441
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3463..3483
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3484..3495
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    3511..3531
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    3538..3570
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3580..3606
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3643..3900
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:238020"
     misc_feature    order(3643..3645,3838..3840,3883..3885)
                     /gene="Obscn"
                     /note="Interdomain contacts [active]"
                     /db_xref="CDD:238020"
     misc_feature    order(3886..3891,3895..3900)
                     /gene="Obscn"
                     /note="Cytokine receptor motif [active]"
                     /db_xref="CDD:238020"
     misc_feature    4090..4275
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    4108..4128
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4147..4164
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4171..4182
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    4195..4212
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    4219..4236
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    4885..5157
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    4894..4905
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    4909..4920
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    4930..4959
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4972..4992
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4999..5007
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    5023..5040
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    5047..5073
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5095..5118
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5125..5157
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5575..5847
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    5575..5586
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    5593..5610
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    5623..5646
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5665..5685
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5686..5697
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    5713..5733
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    5740..5772
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5782..5808
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5812..5847
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5971..6243
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    5986..6000
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    6022..6051
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6064..6081
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6088..6096
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    6112..6129
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6136..6153
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6178..6204
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6211..6243
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6304..6591
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    6304..6312
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    6316..6336
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    6355..6378
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6394..6411
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6415..6426
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    6448..6471
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6484..6507
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6526..6552
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6997..7185
                     /gene="Obscn"
                     /note="Src homology 3 domain of Obscurin and similar
                     proteins; Region: SH3_Obscurin_like; cd12025"
                     /db_xref="CDD:212958"
     misc_feature    order(7018..7020,7024..7026,7033..7035,7051..7053,
                     7105..7110,7165..7167,7171..7176)
                     /gene="Obscn"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212958"
     misc_feature    7282..7812
                     /gene="Obscn"
                     /note="Guanine nucleotide exchange factor for
                     Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous
                     (DH) domain. It appears that PH domains invariably occur
                     C-terminal to RhoGEF/DH domains; Region: RhoGEF; cl02571"
                     /db_xref="CDD:413383"
     misc_feature    order(7291..7293,7303..7305,7669..7674,7681..7686,
                     7690..7695,7702..7707,7714..7719,7726..7728,7804..7806)
                     /gene="Obscn"
                     /note="GTPase interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238091"
     misc_feature    7837..8211
                     /gene="Obscn"
                     /note="Obscurin pleckstrin homology (PH) domain; Region:
                     PH_Obscurin; cd13239"
                     /db_xref="CDD:270059"
     misc_feature    8233..8505
                     /gene="Obscn"
                     /note="First immunoglobulin-like domains A168 within the
                     A-band segment of human cardiac titin, and similar
                     domains; a member of the I-set of IgSF domains; Region:
                     IgI_1_Titin-A168_like; cd20971"
                     /db_xref="CDD:409563"
     misc_feature    8284..8298
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409563"
     misc_feature    8323..8337
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409563"
     misc_feature    8404..8418
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409563"
     misc_feature    8443..8460
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409563"
     misc_feature    8482..8493
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409563"
     misc_feature    8512..8751
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig_3; pfam13927"
                     /db_xref="CDD:404760"
     misc_feature    8512..8523
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    8530..8544
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    8566..8592
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    8605..8622
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    8629..8637
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    8653..8670
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    8683..8700
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    8725..8751
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    8758..8790
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    9277..9546
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    9325..9348
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    9367..9387
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    9388..9399
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    9436..9471
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    9481..9507
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9511..9546
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    9598..10368
                     /gene="Obscn"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:419665"
     misc_feature    order(9625..9639,9643..9645,9649..9651,9688..9690,
                     9694..9696,9778..9780,9826..9831,9835..9837,9847..9849,
                     9853..9855,9964..9966,9970..9972,9976..9981,9985..9987,
                     10021..10026,10033..10035,10078..10089)
                     /gene="Obscn"
                     /note="active site"
                     /db_xref="CDD:270870"
     misc_feature    order(9625..9639,9643..9645,9649..9651,9688..9690,
                     9694..9696,9778..9780,9826..9831,9835..9837,9847..9849,
                     9976..9981,9985..9987,10021..10026)
                     /gene="Obscn"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(9637..9639,9847..9849,9853..9855,9964..9966,
                     9970..9972,9976..9978,10033..10035,10078..10089)
                     /gene="Obscn"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    10021..10089
                     /gene="Obscn"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270870"
     misc_feature    12517..12765
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    12568..12582
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    12607..12621
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    12682..12699
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    12727..12744
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    12769..12780
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    12799..13035
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; Region: FN3; smart00060"
                     /db_xref="CDD:214495"
     misc_feature    13135..13905
                     /gene="Obscn"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:419665"
     misc_feature    order(13165..13179,13183..13185,13189..13191,13228..13230,
                     13234..13236,13318..13320,13366..13371,13375..13377,
                     13387..13389,13393..13395,13504..13506,13510..13512,
                     13516..13521,13525..13527,13555..13560,13567..13569,
                     13618..13629)
                     /gene="Obscn"
                     /note="active site"
                     /db_xref="CDD:270870"
     misc_feature    order(13165..13179,13183..13185,13189..13191,13228..13230,
                     13234..13236,13318..13320,13366..13371,13375..13377,
                     13387..13389,13516..13521,13525..13527,13555..13560)
                     /gene="Obscn"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(13177..13179,13387..13389,13393..13395,13504..13506,
                     13510..13512,13516..13518,13567..13569,13618..13629)
                     /gene="Obscn"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    13555..13629
                     /gene="Obscn"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270870"
ORIGIN      
atgggggcagatacagcctgaggcaggatggggccttgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcgtgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgcccccccagattcacagaagacttgaaaagccaagaggccacagaaggcaccatggtaactctaaggtgccagatgagcaaggtgacccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcatagaagacttgagaagccaagaggccacagaagggaacatggtgactctaaggtgccagatgagcaaggtgacccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcacagaagacttgagaagccaaaaagccacggaaggcaccatggtgactttaaggtgccagatgagcaaggcagcccctgtggagtggaggaaggggtctgagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtatgagctgcagatccgaggcttggctctggaagatgctggggagtactcatgtgtgtgtgggcaggagaagacctcagccacactgagtgtcaaggcccttccagccagattcatagaagatttgagaagccaagaggtcccggaaagttcaacagtcacaatgcggtgtgagctaagcaagaaggcccctgtggtgtggaggaaagggtctgagaccctgaaaaatggggccaggtacagcctgagacaggatggtgctgtgtgtgagctggagatccgtgacctgactgtggaagatgctggagagtactcatgcacatgtgggaaggagaggacctcagccacactgagcattatggctccacaggtggtgttccagaagttactggagaatctgcaagcagaagaaggctccacagccagcctgcggtgtgagctgtcagtccccaacactgctgtggtctggagcaagggcggcctggagctgcaggctgacacatgccgagagacacggcagcagggctgcgttgcagaactgctgcttagggacgtgcgccgtgaggacgcgggcgagtacagctgtacctgtggttcccagaccacaagtgccacactcatggtcacagctgctcctgtgaggttcctccaggagctacaggcccaggacgtagatgaagggaccaccgcacgcctgcgctgtgagctgagccgggaggctgcgagtgtggaatggcgcaagggctccttgcagctttttccttgtgctaagtatcagatggtgcaggagggcacaactgcagagctgctagtccatggggtggagcaggaggatgcaggggaatacacctgcgatgcaggacacatgcagagcattgccaggctctccgtccgagcccccaagcccaagttcaagaccggcctacagagcaaagagcaagaagcaggtggcacagcacggctgtgttgtcaactgagcgaagctgagtcggggactccagtacaatggctcaaagagggggtggagctgcatgtcagctccaagtacgagatgcggtgccaaggggctatgtgtgagttgctgatccacaagctggaggccaaggacactggtgaatatgcctgcgtggtgggtggccagaagaccttggcctccctcagagtcaaagagcctgaggtgaccattgtgcagggactggtggacatggaggtgcaggctgatgaggatgtggagttcacttgcaaggtgtcacaggcaggagccacagatgtgcagtggcatctccaaggtctgccactgcagagcaatgaagtgacagaggtggctgttcttggagacggctgtacccatgtgctccagttgaagggtgtgacactggatgatgctggtactgtctccttccacgtgggcagccattcatcttctgctcagctcatagtccgagtccccgaggtgaccgttctggagcccctgaaggatgtgcagctcagcgagggccaggatgcccatttccagtgccggctgtccagggcttcgggccaggaggctcgctgggctttgggaggagttcccttgcagtgcaatgagatgaatgacatcactgtggagcagggcacactctactcgctcactctgcacaaggtgaccctcgaggatgccggaaccatcactctccaagtgggctcatgctcctcagaggcccagctgaaggtcacagaggcagcactgtgcctggtacgaggcttgcagaatgtggatgtcttcgcgggggaggtggccacgttctcctgtgaggtatctcgagcaggtgggccagaggcccgctggtggctggatggcaccctgcttcagaacagccctgagagtgccatgactgtacgagagggtactgttcactccctcacgctctcgggcctgggggtggctgactcaggcaccatcaccttccgcacggggcccctggtctccacagccaagttattggtcaaagatcccacagtggaggtggtgagtgccatgcaggacctggtggtggaggagggtggctcggccgagctcctctgccagtactcgcggcccgtgcaggccatgtggaagatgaacgagcgggaggtgtgcgcggatgggcaccgtgtcatcatagagcaggactggaccgtagccaggctgaccctcaggccggccctgccctgtgacagtggcatctattcttgtgaggctgcgggcactcgagttgtggcactgctccaagtgcaagccaagaacacagtggtgcgtggcctggagaatgtggatgcactggagggcggcgaagctctgttcgagtgtcagctgtcccagccggaagtggctgcccacacctggttactagacgatgagcctgtgcacacatcagcaaacgtggaggtggtctactttgagaacggactgcgccacttgcttttgctcaaaaacctgaagccacaggacagctgccgagtgaccttcctggcaggggacgtggtcacgtctgccttcctcactgtgagaggctggcgcttggaggtcctggagcccccacaagacgcatctgtgaaagctggtacgcaggtctgcttcacttgcatactaagtgaggccctgcctgtgggcgaggctacttggtacatcaacggggctgccatccaacctgatgacgctgactggatagtcaccgcagatggcagccaccatgccctgacgctgagcaacgcccagccccagcacgcaggagaggtcacatttgcagcacgtgacgccgtggcctctgcacgcctctctgtgttggctctccctggtccccctgaagatgctgaagtagtgggtcgaagtgaccactctgtgaccctatcctgggtggctcccgtgagtgacggcggcggcggtctatgtggttatcgtgtggagatgaaggaggcatccacaggccagtggcagttgtgccatgagttggtacctggcccagagtgtgtggtggacggcctggtctctgggaagacctaccgcttccgagtggcagccgtgggtccggcaggagctggggagcctgtacatctgccccagatggtcaagatagcagagccaatggaacctaaaccagccccagccccagcccctgccctagccccaaccccagctccaatcccaaccccagccccagccccagccccagccccaaccccagccccaaccccaaccccagccccagccccagcccctgccccagccccagcaacacggcgagcagtggttggtgaagatgtgtgtctggagctggaagtggcagctgatgctggcgaggtcgtctggcacaagggaacagagcgcatccatcccagtgggcactttgaggtcctctctcagggtcagcggcagatgctggtgatcaagggctttaggaccgaagaccagggggagtaccgctgtggtcccatccagggcctgccctcctcaggagcttctactttcaatgtggtcgtgacctcgggctcggaggatgaggtccctgcacagcccagcctgcctcccgaggcagcccaggagggtgacctgcatctgctttgggaggcccttgctcggaagcgtcgcatgagccgggagcccacgctggactccatcagtgagctgcccgaggaagacagccgtgtgcagcatctgcggcaggaggcagaagaggcggctcctgacctctctgagggctactccacagccgatgagctcgcacgcacaggagaagctgacctctcacacaccagctctgatgacgagtctcgggctggcaccccttccctaattacctacctcaagaaggccgggggtcctgggatctcacccttggccagcaagcatgaggcccaggtggccacgtctgtgaagccacaaaagcagcaggagcgggttgtgcccacatgcccactgccgggagatttgaacgcagcagatttgaaggatccatccctggacaaggccgctgtgaagatccaggctgcctttaagggctacaaagtgaggaaggagatgaagcagcagggaggccccgtgttctcacggacatttggggacacagaggcacaggttggggatgcgctgcggctggagtgtgtggtgtccaccaaggctgacgtgcgggcctgctggttgaaggatggcgtagagttaacagatgggcgccattaccacatagaccagctcaaggacggtacctgctctctgctggtcactggcctgggccccactgactctggtcgctacacctgtcaggtgagcaccaagtttggaagcgtgagccacagtgcctgcgtaatggtcagtgggacagaaagtgaggctgagagctcctcaggaggtgagctggacgatgccttccgccgggcagcacgacgcctgcatcgtctcttccgaaccaagagcccagctgagctttcagaagaggagctcttcctcagtgctgacgaaggccccatggagccagaggagcctgcagactggcaaacataccgagaggatgaaaactttgtgtgcatccgttttgagtcacttgcagaggcccaccgggcagtcacctgcttccgtgacatgtttgccaccatgggcatcggggtggagatcagcctaggggagcaggggccccggggagtggagatgcgcattggcaaggtggcccccactgtcatccctgcggtgccacttgcaaagacacctggcctgcagacttcagatgctgccccagtgttcctgacggagctgcagaaccaagacgtgcaggacggataccccatgagcttcgactgcgtggtaacaggccagcctgtgcccagtgtgcgctggttcaaggacgggaagttgctagaagaggatgaccactacatgatcaacgaggaccaacaggggggtcaccagctcatcatcacagccgtggtgccggcagacatgggagtgtaccgctgcctggcggagaacagcatgggcgtctcctccaccaaggctgagcttcgtgtggaattgaccagcacagactatgacactgctgctgatgctaccgagacctcatcctacttcagcgcccagggatacctgtccagccgggagcaagaggggacggagtcagatgaggggcagcttccccaggtgctggaggaactgaaagacctccaggtggcccctggcacacgcctggccaagttccagctcaaggtgaaaggttatccagctcccaaactgtactggttcaaagatggccagcccctgaccacatctgaccacatccgcatgactgacaaaaagaccctgcacaccctggagattgtctccatcacccgagaggacagcggccagtacgcggcctacatcagcaatgctgtgggtgccgcctattcgtcagcccggctgctggtccgaggtcccagtgaaccagaagagaagccacaaccagatgttcatgagaggctggtgccaccccgaatcctggagaagttcacccccaagaaagtgaagaggggctccagcatcaccttttcagtgaaggtggaaggacacccggcccccagtgtgcattggctcaaggaggaggcagagaagggagtcctgtggattggccctgatacccctggctacacgatggccagttcttccaagcaacatagcctggtcctgctggacgtaggccgacagcaccagggcacctacacgtgcattgccaccaatgctgctggccaggcgctctgctctgccagtctgcacatctctggcttggccaaagaagaggagcaggagagagtgaaggaggctctcatttcctccttcctgcaagggacgagccaagctgtctcagcccagatgtcagaatctgcaagttttgctgatcttgtcgggcaaaggaaaggtgagtccctggtggctgaggaggcccacagtcacctgtccctttctgaggtgggcacagaagagttcctgcagaaactcacctcacagatcaccgagatggtatcagccaagatctcgcaggccaaactccaggtgcctggaggtgacagtgatgaggagtctaagacaccatctgcttctcctcggcacggccggtcacgtccttcctccagtgttcaagagtcttcctcagagtcagaggatggagactcccgtggtgagatctttgacatctacgtggtcacagctgattatctgcccctgggagctgagcaggatgccatcatcctgagagaaggccagtatgtggaggtcctggactcagcccatcccctgcgctggcttgtacgcaccaagcccaccaaatccagcccttccaggcagggctgggtgtcacctgcctacctggacaagaggctcaagctatctcctgagtgggggcccactgaggcccctgagttccctggcgaggctgtgtctgaggatgagtatagaacgaggctgagctctgtcatccaggagttgctgagttcagagcaggcttttgtgggtgagttacagttcttggagagccaccacatcaagcacctggaccgatctccccgtgtacccgcagctgtggccagccagaagacggtcatctttcgtaatgtgcaggacatcagccatttccacagcagcttcttgaaggagctgcagagctgtggcaccgacgatgatgtagccatgtgcttcatcaagaaccaggaggcctttgagaagtaccttgagttcctggtgggccgggtgcaagcggaatcagtggtcgtcagcaccccagtccaggagttctacaagaaatatgcagaagagatgctgtcagccaaggaccccacacagccacccccacctcctcttcagcactacttggagcagccagtggaacgggtgcagaaataccaggccttgctgaaggagctaatccgcaacaaggctcgcaaccggcagaactgtgcgctgctggagcaggcctacgctgtggtgtctgccctgcctcagcgtgctgagaacaagctgcacgtttctctcatggagaactacccgggaaccctggaggccctgggagaacctatccgccagggtcacttcatagtgtgggagggggctccaggagcccggatgccttggaagggccacaaccggcatgtcttcctcttccgaaaccacctggtgatctgcaagccccggagagactctcgaacggacaccttcagctacgtgttccggaacatgatgaagctgaatagcatcgacctgaatgaccaggtagagggggatgaccgtgcctttgaggtgtggcacgagcgggaagactctgtccgcaagtacctgctgcaggcgcggacagtgatcatcaaaaactcatgggtgaaggagatctgtggcatccagcagcgccttgcccagcccgtgtggcgtccccctgagtttgaagaagaactagctgactgcacagccgagctgggtgaaacagtcaagctagcatgccgagtgactggcacacctaagcctattgtcagctggtacaaagatgggaagcccgtggaggtggacccacaccacatcctcattgaagaccctgatggctcctgtaccctcatcttggacaaccttactggcatagactctggccagtacatgtgttttgcggccagtgctgctggcaatgccagcaccttggggaagattctagtacaagtgcccccacgatttgtgaacaaggtccgagccacaccctttgtggagggagaggacgcgcagatcacctgcacagtggaaggagctccgtaccctcagatcaggtggtacaaggacggtgccctgctaaccctgggcaacaggtaccggatggtgaatgagccccgcagtggtatgctggtgctggtgatccaggcagccagcaaggaggacctgggacactatgaatgtgagttggtgaaccggttgggctcaacacgttgtggcggagaattatacatgcagagtcccgcactgcgtgcctgggaccagcaccaccgggaacagcttgtggctgctgtggaagacgcctccatggaggactctgcccaccccactcaggagggagctgaccaacaagccgcttctgtcctttggaggctgctgggctcagaagccctcagcccctccccagggggtttccccaacaccagacaaagtgagccacccacatcagaagaggctgctccccagatcccaggcacaacttcaggaacacctggcaaactcccagaggcttcacggcccggcacatacaaaggcctggagcaggggatgacaacaacttctggatcccaggaacggaatgtacccattcgggtggagggcacggcctggccaggcggaggcactgggcagctgctcttggatgtgcacagccaagtcatcatggagaccacacagaggacctatgtgtgccaagctcctgacacaggtgtcacaagggccccatccatgcaggtcactatcgaggacctacaagtacaagtgggtgacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtggaaggcctacactacctgcacagccatgatatcctccatctggacataaagccccccaacatcctgatggtccacccagctcgggaagacattaagatctgtgactttggctttgcccaaaagatcaccccgtcagagccacagtacagcaagtatggctcacctgaattcgtgtccccagagatcatcgagcagagtcctgtgagtgagggctcagacatctgggccatgggcgtcatctcctacctcagcctcacctgttcatccccattcgctggagagagtgaccgtgccaccctgctcaatgttttggaggggcgggtctcttggagcagtcccatggctgcccatctgagtgaggatgccaaggacttcatcaaggccacactgcaaaagacccccagggcccggcctagtgcttcccagtgccttgctcacccctggttcctgaagtccatgcctgctgaggaggcccacttcatcaacaccaaacagctcaagttccttcttgctcgcagtcgctggcagcgttccttgatgagctacaagtctatcctggtgatgcgctccatccctgagctgctccagggtcctccagacagtccatctctaggagtggcccggcacctacgaggggaagccagcggatcctctagctcatcgtcttcctcggacaatgagcttgccccatttgccagggctaagtcactgccaccttcccctgtcactcactcgccactgctgcaccctcggggctttctgcggccttcagccagcctcccggaggagacagaggccagcatgtccactgctgatgcagccatgccggcacccccccagagtgctgggcctccagcaagcccaggttgtgtgccccggcacagcgtcatcagcagcttgttctaccagcaagctggtgagggtgcagagcgtgggagcaaagcgttgggcgccaagaggcacccagctcggagacgccacctgctaaagggcgggtacattgcaagggccctgcccgggctacgagagccgctgatggagtttagtgtgttggaggaagaggctgctaatgaggagcaggcctctctgatgaccaagacaccctcctttgagaccgctctgcgactacctagttccaatgtcagagaggtcccaggccgaagccgctccctggacaacccaccaggcacagccagcccctctcctgaggcatacaaggaacaatacctgtccccaccctcctcggggttgactcatgaaaccaccgccaagggcatgggacacaaagaagggttcttgcaggagtctgtccccttttcacctaccagtggtgacctgaggcctgttaagcaagaggggtcatcccaggatagctgtagagggaaaccagcctcttcctgtcactctgaactgggttctggtccgcaggagggctgtggctctccatcatcacaattgtgtggctccttacctccacagtcatcgaagaaagagctctcaaaaccctgtggcccactcttttcagaacagcctcaggcagccccattcccagcgcaagcaagcccccttctgggttctcagaaggaacctcaggatagctatctacctgaaaagccatgtccagttccctccagttctccagggtcagcctcccaagtagatgcatccctggataccgaaggcttgtcggaagctggggacacatgtgacttcacgcctcctctccagcggcctcaggagcaggccaccacccggaagttctctctggaatcccgtgggggctatgcaggggtggcaggatatggcaccttcgcctttggtggggatgcaggggggatgttagggcagggtcccctttgggccaggatggcctgggctgtgtcccagtcctcagaagagcaagatgaagcagcgactgagagccctcaacctctggacagctcagggcccattgctgaggccagtggggttcccctaaggacctcgccaagcctcaccccatgggaggaagttgagcaggtttccctggtacagatccgggatctgtctggtgatgcagaagcagccgacaccatctccttggacatttcagaggtagatcctgcctacctcaacctctccgatctatatgacatcaagtatctcccgtttgagttcatgatcttcaggagggtccccaaacctgtagagcagccagagtcacctggctctgaaactgaagaggggcaagggctggcggagttcctggaggaggctgtgtggccctggccaggcgagctgggactgcgtgctggtctggagattacagaggagccacaggagccaggggacctggaagcactgctgggcgaggctgctgtgggcaggaagcgcaagtggtccccctcccgtggcctcttccaattccctgggaggtgcctgtcaggggaggagcccgtggagcttgggctgcgccagagggtgaaggcttccatggctcacatctccaggatcctgaagggcaagccggaaggtcctgagaaggaagggcctcccagaaagaaggcaggcctagcttctttccggctatcaggcctgaagggcagggaccaagcgccatccttcctaagagaactctctgatgaggctgtggtcctgggccaatcagtgacactggcctgccaggtgttggcccagccaactgcccaggctacctggagcaaagatggggcccttctggagagcagcggccacctcctcatctcttccaccctgaagaacttccagctgctgaccattctggtggtgacggaggaggatctgggcacatatacctgctgtgtgagcaacccactagggacagcagtcaccacaggtgtcctccggaaagcagagcgcccttcatcttctccacgcccggaggtgggggaactatacacggatgcagtgttgctggtctggaagcctgtggaatcctatggcccagtgacctacattgtgcagtgctgtatagaaggaggcagctggacaaccctggcctctgacatctccgactgctgctacctcactggcaagctgccccggggtggcatgtataccttccggacagcatgtgtcagcaaagcaggaatgggcccctacagtagcccctcagaacaggtcctccttggaggacccaaccacctggcttctgaggaggaaagcagccgggggagaccagcccagcttcttcccagcacaaagacttttgccttccagacacagatccggaggggccgcttcagtgtggtgaggcagtgtagggagaaagcaagtgggcgggccctggctgctaagatcgttccctaccagcctgaggacaagacaactgtactaagagaatatgaggcactaaagagactgcaccacccacatctggcccaactccatgctgcctacctcagtccccggcacctggtgctcatcctagagctgtgctctggccctgagctgctaccctctctggcggagagggactcgtactcagagtctgatgtgaaggactacctgtggcagatgctcagtgccacccagtacctgcatgcccaacacatcctgcacctggacctgaggtcggagaacatgatggtcaccgagtacaacctgcttaaggttatagacctgggtaacgcccagagtctcagccaagagaaggtcccacctcctgaaaacttcaaagactacctagagaccatggctccagaacttctggaaggccaaggggcggttccacagacagacatctgggctattggtgtaacagccttcattatgctgagtggcgagtacccagtgagcagcgaggggactcgcgacctgcagaaaggcctgcgcaagggactcattcaattgagtcgctgctatgcaggattatcagggggtgcggtagccttcctgcagagttcattgtgcgctcggccctggggtcgcccgtgcgcttccacctgcttgcagtgcgggtggctgacggaggagggccccaccggttcccggcccacgcccgtgaccttccccaccgcgcgattgcgtgcctttgtgcgcgagcgcgagaagcgccgggcgctactctacaagaagcacaacctggctcaggtgcgctgaggcccagccctacagagcaagatgtgcccgccaataaaagatgcaaaacagcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]