GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 10:40:37, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_039087256           14358 bp    mRNA    linear   ROD 21-JAN-2021
DEFINITION  PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and
            titin-interacting RhoGEF (Obscn), transcript variant X35, mRNA.
ACCESSION   XM_039087256
VERSION     XM_039087256.1
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051345.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rattus norvegicus Annotation Release
                                           108
            Annotation Version          :: 108
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..14358
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..14358
                     /gene="Obscn"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 23 ESTs, 2 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 6 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:338458"
                     /db_xref="RGD:631335"
     CDS             193..14304
                     /gene="Obscn"
                     /codon_start=1
                     /product="obscurin isoform X33"
                     /protein_id="XP_038943184.1"
                     /db_xref="GeneID:338458"
                     /db_xref="RGD:631335"
                     /translation="
MVTLRCQMSKVTPVEWRKGSETLRDGGRYSLRQDGAVCELQIHRLALEDAGEYSCLCGQEKTSATLSVKALPPKFTEGLKKEEATEGNMATLRCQMSKAAPVEWRKGSETLRDGGRYSLRQDGAACELQIRGLALEDAGEYSCLCGQEKTSATLSVKALPPRFIEDLRSQEATEGNMVTLRCQMSKVTPVEWRKGSETLRDGGRYSLRQDGAVCELQIHRLALEDAGEYSCLCGQEKTSATLSVKALPPRFTEDLRSQKATEGTMVTLRCQMSKAAPVEWRKGSETLRDGGRYSLRQDGAVYELQIRGLALEDAGEYSCVCGQEKTSATLSVKALPARFIEDLRSQEVPESSTVTMRCELSKKAPVVWRKGSETLKNGARYSLRQDGAVCELEIRDLTVEDAGEYSCTCGKERTSATLSIMAPQVVFQKLLENLQAEEGSTASLRCELSVPNTAVVWSKGGLELQADTCRETRQQGCVAELLLRDVRREDAGEYSCTCGSQTTSATLMVTAAPVRFLQELQAQDVDEGTTARLRCELSREAASVEWRKGSLQLFPCAKYQMVQEGTTAELLVHGVEQEDAGEYTCDAGHMQSIARLSVRAPKPKFKTGLQSKEQEAGGTARLCCQLSEAESGTPVQWLKEGVELHVSSKYEMRCQGAMCELLIHKLEAKDTGEYACVVGGQKTLASLRVKEPEVTIVQGLVDMEVQADEDVEFTCKVSQAGATDVQWHLQGLPLQSNEVTEVAVLGDGCTHVLQLKGVTLDDAGTVSFHVGSHSSSAQLIVRVPEVTVLEPLKDVQLSEGQDAHFQCRLSRASGQEARWALGGVPLQCNEMNDITVEQGTLYSLTLHKVTLEDAGTITLQVGSCSSEAQLKVTEAALCLVRGLQNVDVFAGEVATFSCEVSRAGGPEARWWLDGTLLQNSPESAMTVREGTVHSLTLSGLGVADSGTITFRTGPLVSTAKLLVKDPTVEVVSAMQDLVVEEGGSAELLCQYSRPVQAMWKMNEREVCADGHRVIIEQDWTVARLTLRPALPCDSGIYSCEAAGTRVVALLQVQAKNTVVRGLENVDALEGGEALFECQLSQPEVAAHTWLLDDEPVHTSANVEVVYFENGLRHLLLLKNLKPQDSCRVTFLAGDVVTSAFLTVRGWRLEVLEPPQDASVKAGTQVCFTCILSEALPVGEATWYINGAAIQPDDADWIVTADGSHHALTLSNAQPQHAGEVTFAARDAVASARLSVLALPGPPEDAEVVGRSDHSVTLSWVAPVSDGGGGLCGYRVEMKEASTGQWQLCHELVPGPECVVDGLVSGKTYRFRVAAVGPAGAGEPVHLPQMVKIAEPMEPKPAPAPAPALAPTPAPIPTPAPAPAPAPTPAPTPTPAPAPAPAPAPATRRAVVGEDVCLELEVAADAGEVVWHKGTERIHPSGHFEVLSQGQRQMLVIKGFRTEDQGEYRCGPIQGLPSSGASTFNVVVTSGSEDEVPAQPSLPPEAAQEGDLHLLWEALARKRRMSREPTLDSISELPEEDSRVQHLRQEAEEAAPDLSEGYSTADELARTGEADLSHTSSDDESRAGTPSLITYLKKAGGPGISPLASKHEAQVATSVKPQKQQERVVPTCPLPGDLNAADLKDPSLDKAAVKIQAAFKGYKVRKEMKQQGGPVFSRTFGDTEAQVGDALRLECVVSTKADVRACWLKDGVELTDGRHYHIDQLKDGTCSLLVTGLGPTDSGRYTCQVSTKFGSVSHSACVMVSGTESEAESSSGGELDDAFRRAARRLHRLFRTKSPAELSEEELFLSADEGPMEPEEPADWQTYREDENFVCIRFESLAEAHRAVTCFRDMFATMGIGVEISLGEQGPRGVEMRIGKVAPTVIPAVPLAKTPGLQTSDAAPVFLTELQNQDVQDGYPMSFDCVVTGQPVPSVRWFKDGKLLEEDDHYMINEDQQGGHQLIITAVVPADMGVYRCLAENSMGVSSTKAELRVELTSTDYDTAADATETSSYFSAQGYLSSREQEGTESDEGQLPQVLEELKDLQVAPGTRLAKFQLKVKGYPAPKLYWFKDGQPLTTSDHIRMTDKKTLHTLEIVSITREDSGQYAAYISNAVGAAYSSARLLVRGPSEPEEKPQPDVHERLVPPRILEKFTPKKVKRGSSITFSVKVEGHPAPSVHWLKEEAEKGVLWIGPDTPGYTMASSSKQHSLVLLDVGRQHQGTYTCIATNAAGQALCSASLHISGLAKEEEQERVKEALISSFLQGTSQAVSAQMSESASFADLVGQRKGESLVAEEAHSHLSLSEVGTEEFLQKLTSQITEMVSAKISQAKLQVPGGDSDEESKTPSASPRHGRSRPSSSVQESSSESEDGDSRGEIFDIYVVTADYLPLGAEQDAIILREGQYVEVLDSAHPLRWLVRTKPTKSSPSRQGWVSPAYLDKRLKLSPEWGPTEAPEFPGEAVSEDEYRTRLSSVIQELLSSEQAFVGELQFLESHHIKHLDRSPRVPAAVASQKTVIFRNVQDISHFHSSFLKELQSCGTDDDVAMCFIKNQEAFEKYLEFLVGRVQAESVVVSTPVQEFYKKYAEEMLSAKDPTQPPPPPLQHYLEQPVERVQKYQALLKELIRNKARNRQNCALLEQAYAVVSALPQRAENKLHVSLMENYPGTLEALGEPIRQGHFIVWEGAPGARMPWKGHNRHVFLFRNHLVICKPRRDSRTDTFSYVFRNMMKLNSIDLNDQVEGDDRAFEVWHEREDSVRKYLLQARTVIIKNSWVKEICGIQQRLAQPVWRPPEFEEELADCTAELGETVKLACRVTGTPKPIVSWYKDGKPVEVDPHHILIEDPDGSCTLILDNLTGIDSGQYMCFAASAAGNASTLGKILVQVPPRFVNKVRATPFVEGEDAQITCTVEGAPYPQIRWYKDGALLTLGNRYRMVNEPRSGMLVLVIQAASKEDLGHYECELVNRLGSTRCGGELYMQSPALRAWDQHHREQLVAAVEDASMEDSAHPTQEGADQQAASVLWRLLGSEALSPSPGGFPNTRQSEPPTSEEAAPQIPGTTSGTPGKLPEASRPGTYKGLEQGMTTTSGSQERNVPIRVEGTAWPGGGTGQLLLDVHSQVIMETTQRTYVCQAPDTGVTRAPSMQVTIEDLQVQVGDMAQFDAVIEGNPPPTVTWYKDSNQLVNGTRLRQQQGGTTYSLVLMDVTPHDAGVYTCVAQNAGGQVLCKAELLVYGGDKSDAEKQAYRRKLHSFYEVQEEIGRGVFGFVKRVQHKGNKMSCAAKFIPLRSKTRAQAYQERDILATLSHPLVTGLLDQFETQKTLILILELCSSEELLDRLFKKAVVTEAEVKVYIQQLVEGLHYLHSHDILHLDIKPPNILMVHPAREDIKICDFGFAQKITPSEPQYSKYGSPEFVSPEIIEQSPVSEGSDIWAMGVISYLSLTCSSPFAGESDRATLLNVLEGRVSWSSPMAAHLSEDAKDFIKATLQKTPRARPSASQCLAHPWFLKSMPAEEAHFINTKQLKFLLARSRWQRSLMSYKSILVMRSIPELLQGPPDSPSLGVARHLRGEASGSSSSSSSSDNELAPFARAKSLPPSPVTHSPLLHPRGFLRPSASLPEETEASMSTADAAMPAPPQSAGPPASPGCVPRHSVISSLFYQQAGEGAERGSKALGAKRHPARRRHLLKGGYIARALPGLREPLMEFSVLEEEAANEEQASLMTKTPSFETALRLPSSNVREVPGRSRSLDNPPGTASPSPEAYKEQYLSPPSSGLTHETTAKGMGHKEGFLQESVPFSPTSGDLRPVKQEGSSQDSCRGKPASSCHSELGSGPQEGCGSPSSQLCGSLPPQSSKKELSKPCGPLFSEQPQAAPFPAQASPLLGSQKEPQDSYLPEKPCPVPSSSPGSASQVDASLDTEGLSEAGDTCDFTPPLQRPQEQATTRKFSLESRGGYAGVAGYGTFAFGGDAGGMLGQGPLWARMAWAVSQSSEEQDEAATESPQPLDSSGPIAEASGVPLRTSPSLTPWEEVEQVSLVQIRDLSGDAEAADTISLDISEVDPAYLNLSDLYDIKYLPFEFMIFRRVPKPVEQPESPGSETEEGQGLAEFLEEAVWPWPGELGLRAGLEITEEPQEPGDLEALLGEAAVGRKRKWSPSRGLFQFPGRCLSGEEPVELGLRQRVKASMAHISRILKGKPEGPEKEGPPRKKAGLASFRLSGLKGRDQAPSFLRELSDEAVVLGQSVTLACQVLAQPTAQATWSKDGALLESSGHLLISSTLKNFQLLTILVVTEEDLGTYTCCVSNPLGTAVTTGVLRKAERPSSSPRPEVGELYTDAVLLVWKPVESYGPVTYIVQCCIEGGSWTTLASDISDCCYLTGKLPRGGMYTFRTACVSKAGMGPYSSPSEQVLLGGPNHLASEEESSRGRPAQLLPSTKTFAFQTQIRRGRFSVVRQCREKASGRALAAKIVPYQPEDKTTVLREYEALKRLHHPHLAQLHAAYLSPRHLVLILELCSGPELLPSLAERDSYSESDVKDYLWQMLSATQYLHAQHILHLDLRSENMMVTEYNLLKVIDLGNAQSLSQEKVPPPENFKDYLETMAPELLEGQGAVPQTDIWAIGVTAFIMLSGEYPVSSEGTRDLQKGLRKGLIQLSRCYAGLSGGAVAFLQSSLCARPWGRPCASTCLQCGWLTEEGPTGSRPTPVTFPTARLRAFVREREKRRALLYKKHNLAQVR"
     misc_feature    196..396
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    196..210
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    232..243
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    304..318
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    409..660
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    457..477
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    493..510
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    517..528
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    541..558
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    565..582
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    607..627
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    634..660
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    670..681
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    673..924
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    688..702
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    724..750
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    778..789
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    805..822
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    829..846
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    892..924
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    937..1188
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    961..975
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    985..1005
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1021..1038
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1045..1056
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1069..1086
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1093..1110
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1135..1155
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1162..1188
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1204..1452
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1213..1233
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    1252..1275
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1288..1302
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1306..1317
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1330..1344
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1357..1380
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1468..1719
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1474..1482
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    1489..1503
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    1513..1533
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1552..1569
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1576..1587
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1600..1617
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1624..1641
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1666..1686
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1693..1719
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1735..1986
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1780..1800
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1819..1836
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1843..1854
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1867..1884
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1891..1908
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1933..1953
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1960..1986
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2035..2259
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2047..2067
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2092..2109
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2116..2127
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2140..2157
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    2164..2181
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2206..2226
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    2233..2259
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2278..2535
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2323..2337
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2362..2376
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2437..2457
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2542..2808
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2566..2583
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    2596..2619
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2638..2658
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2659..2670
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2686..2706
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    2713..2745
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2773..2808
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2830..3045
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2839..2856
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    2869..2892
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2911..2931
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2932..2943
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2959..2979
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    2986..3018
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3115..3315
                     /gene="Obscn"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:214652"
     misc_feature    3364..3621
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3637..3897
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3652..3669
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    3682..3705
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3727..3747
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3748..3759
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    3775..3795
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    3802..3834
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3844..3870
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3907..4164
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:238020"
     misc_feature    order(3907..3909,4102..4104,4147..4149)
                     /gene="Obscn"
                     /note="Interdomain contacts [active]"
                     /db_xref="CDD:238020"
     misc_feature    order(4150..4155,4159..4164)
                     /gene="Obscn"
                     /note="Cytokine receptor motif [active]"
                     /db_xref="CDD:238020"
     misc_feature    4354..4539
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    4372..4392
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4411..4428
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4435..4446
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    4459..4476
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    4483..4500
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5149..5421
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    5158..5169
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    5173..5184
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    5194..5223
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5236..5256
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5263..5271
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    5287..5304
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    5311..5337
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5359..5382
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5389..5421
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5839..6111
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    5839..5850
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    5857..5874
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    5887..5910
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5929..5949
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5950..5961
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    5977..5997
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6004..6036
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6046..6072
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6076..6111
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6235..6507
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    6250..6264
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    6286..6315
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6328..6345
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6352..6360
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    6376..6393
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6400..6417
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6442..6468
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6475..6507
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6568..6855
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    6568..6576
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    6580..6600
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    6619..6642
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6658..6675
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6679..6690
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    6712..6735
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6748..6771
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6790..6816
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    7261..7449
                     /gene="Obscn"
                     /note="Src homology 3 domain of Obscurin and similar
                     proteins; Region: SH3_Obscurin_like; cd12025"
                     /db_xref="CDD:212958"
     misc_feature    order(7282..7284,7288..7290,7297..7299,7315..7317,
                     7369..7374,7429..7431,7435..7440)
                     /gene="Obscn"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212958"
     misc_feature    7546..8076
                     /gene="Obscn"
                     /note="Guanine nucleotide exchange factor for
                     Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous
                     (DH) domain. It appears that PH domains invariably occur
                     C-terminal to RhoGEF/DH domains; Region: RhoGEF; cl02571"
                     /db_xref="CDD:413383"
     misc_feature    order(7555..7557,7567..7569,7933..7938,7945..7950,
                     7954..7959,7966..7971,7978..7983,7990..7992,8068..8070)
                     /gene="Obscn"
                     /note="GTPase interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238091"
     misc_feature    8101..8475
                     /gene="Obscn"
                     /note="Obscurin pleckstrin homology (PH) domain; Region:
                     PH_Obscurin; cd13239"
                     /db_xref="CDD:270059"
     misc_feature    8497..8769
                     /gene="Obscn"
                     /note="First immunoglobulin-like domains A168 within the
                     A-band segment of human cardiac titin, and similar
                     domains; a member of the I-set of IgSF domains; Region:
                     IgI_1_Titin-A168_like; cd20971"
                     /db_xref="CDD:409563"
     misc_feature    8548..8562
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409563"
     misc_feature    8587..8601
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409563"
     misc_feature    8668..8682
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409563"
     misc_feature    8707..8724
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409563"
     misc_feature    8746..8757
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409563"
     misc_feature    8776..9015
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig_3; pfam13927"
                     /db_xref="CDD:404760"
     misc_feature    8776..8787
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    8794..8808
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    8830..8856
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    8869..8886
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    8893..8901
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    8917..8934
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    8947..8964
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    8989..9015
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9022..9054
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    9541..9810
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    9589..9612
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    9631..9651
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    9652..9663
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    9700..9735
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    9745..9771
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9775..9810
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    9862..10632
                     /gene="Obscn"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:419665"
     misc_feature    order(9889..9903,9907..9909,9913..9915,9952..9954,
                     9958..9960,10042..10044,10090..10095,10099..10101,
                     10111..10113,10117..10119,10228..10230,10234..10236,
                     10240..10245,10249..10251,10285..10290,10297..10299,
                     10342..10353)
                     /gene="Obscn"
                     /note="active site"
                     /db_xref="CDD:270870"
     misc_feature    order(9889..9903,9907..9909,9913..9915,9952..9954,
                     9958..9960,10042..10044,10090..10095,10099..10101,
                     10111..10113,10240..10245,10249..10251,10285..10290)
                     /gene="Obscn"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(9901..9903,10111..10113,10117..10119,10228..10230,
                     10234..10236,10240..10242,10297..10299,10342..10353)
                     /gene="Obscn"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    10285..10353
                     /gene="Obscn"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270870"
     misc_feature    12781..13029
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    12832..12846
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    12871..12885
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    12946..12963
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    12991..13008
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    13033..13044
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    13063..13299
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; Region: FN3; smart00060"
                     /db_xref="CDD:214495"
     misc_feature    13399..14169
                     /gene="Obscn"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:419665"
     misc_feature    order(13429..13443,13447..13449,13453..13455,13492..13494,
                     13498..13500,13582..13584,13630..13635,13639..13641,
                     13651..13653,13657..13659,13768..13770,13774..13776,
                     13780..13785,13789..13791,13819..13824,13831..13833,
                     13882..13893)
                     /gene="Obscn"
                     /note="active site"
                     /db_xref="CDD:270870"
     misc_feature    order(13429..13443,13447..13449,13453..13455,13492..13494,
                     13498..13500,13582..13584,13630..13635,13639..13641,
                     13651..13653,13780..13785,13789..13791,13819..13824)
                     /gene="Obscn"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(13441..13443,13651..13653,13657..13659,13768..13770,
                     13774..13776,13780..13782,13831..13833,13882..13893)
                     /gene="Obscn"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    13819..13893
                     /gene="Obscn"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270870"
ORIGIN      
atgggggcagatacagcctgaggcaggatggggccttgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcgtgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgcccccccagattcacagaagacttgaaaagccaagaggccacagaaggcaccatggtaactctaaggtgccagatgagcaaggtgacccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggcactgccccccaagttcacagagggtctgaaaaaggaagaggccacagaagggaacatggcgactctgaggtgccagatgagcaaggcggcccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgcgtgtgagctgcagatccgtggtctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcatagaagacttgagaagccaagaggccacagaagggaacatggtgactctaaggtgccagatgagcaaggtgacccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcacagaagacttgagaagccaaaaagccacggaaggcaccatggtgactttaaggtgccagatgagcaaggcagcccctgtggagtggaggaaggggtctgagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtatgagctgcagatccgaggcttggctctggaagatgctggggagtactcatgtgtgtgtgggcaggagaagacctcagccacactgagtgtcaaggcccttccagccagattcatagaagatttgagaagccaagaggtcccggaaagttcaacagtcacaatgcggtgtgagctaagcaagaaggcccctgtggtgtggaggaaagggtctgagaccctgaaaaatggggccaggtacagcctgagacaggatggtgctgtgtgtgagctggagatccgtgacctgactgtggaagatgctggagagtactcatgcacatgtgggaaggagaggacctcagccacactgagcattatggctccacaggtggtgttccagaagttactggagaatctgcaagcagaagaaggctccacagccagcctgcggtgtgagctgtcagtccccaacactgctgtggtctggagcaagggcggcctggagctgcaggctgacacatgccgagagacacggcagcagggctgcgttgcagaactgctgcttagggacgtgcgccgtgaggacgcgggcgagtacagctgtacctgtggttcccagaccacaagtgccacactcatggtcacagctgctcctgtgaggttcctccaggagctacaggcccaggacgtagatgaagggaccaccgcacgcctgcgctgtgagctgagccgggaggctgcgagtgtggaatggcgcaagggctccttgcagctttttccttgtgctaagtatcagatggtgcaggagggcacaactgcagagctgctagtccatggggtggagcaggaggatgcaggggaatacacctgcgatgcaggacacatgcagagcattgccaggctctccgtccgagcccccaagcccaagttcaagaccggcctacagagcaaagagcaagaagcaggtggcacagcacggctgtgttgtcaactgagcgaagctgagtcggggactccagtacaatggctcaaagagggggtggagctgcatgtcagctccaagtacgagatgcggtgccaaggggctatgtgtgagttgctgatccacaagctggaggccaaggacactggtgaatatgcctgcgtggtgggtggccagaagaccttggcctccctcagagtcaaagagcctgaggtgaccattgtgcagggactggtggacatggaggtgcaggctgatgaggatgtggagttcacttgcaaggtgtcacaggcaggagccacagatgtgcagtggcatctccaaggtctgccactgcagagcaatgaagtgacagaggtggctgttcttggagacggctgtacccatgtgctccagttgaagggtgtgacactggatgatgctggtactgtctccttccacgtgggcagccattcatcttctgctcagctcatagtccgagtccccgaggtgaccgttctggagcccctgaaggatgtgcagctcagcgagggccaggatgcccatttccagtgccggctgtccagggcttcgggccaggaggctcgctgggctttgggaggagttcccttgcagtgcaatgagatgaatgacatcactgtggagcagggcacactctactcgctcactctgcacaaggtgaccctcgaggatgccggaaccatcactctccaagtgggctcatgctcctcagaggcccagctgaaggtcacagaggcagcactgtgcctggtacgaggcttgcagaatgtggatgtcttcgcgggggaggtggccacgttctcctgtgaggtatctcgagcaggtgggccagaggcccgctggtggctggatggcaccctgcttcagaacagccctgagagtgccatgactgtacgagagggtactgttcactccctcacgctctcgggcctgggggtggctgactcaggcaccatcaccttccgcacggggcccctggtctccacagccaagttattggtcaaagatcccacagtggaggtggtgagtgccatgcaggacctggtggtggaggagggtggctcggccgagctcctctgccagtactcgcggcccgtgcaggccatgtggaagatgaacgagcgggaggtgtgcgcggatgggcaccgtgtcatcatagagcaggactggaccgtagccaggctgaccctcaggccggccctgccctgtgacagtggcatctattcttgtgaggctgcgggcactcgagttgtggcactgctccaagtgcaagccaagaacacagtggtgcgtggcctggagaatgtggatgcactggagggcggcgaagctctgttcgagtgtcagctgtcccagccggaagtggctgcccacacctggttactagacgatgagcctgtgcacacatcagcaaacgtggaggtggtctactttgagaacggactgcgccacttgcttttgctcaaaaacctgaagccacaggacagctgccgagtgaccttcctggcaggggacgtggtcacgtctgccttcctcactgtgagaggctggcgcttggaggtcctggagcccccacaagacgcatctgtgaaagctggtacgcaggtctgcttcacttgcatactaagtgaggccctgcctgtgggcgaggctacttggtacatcaacggggctgccatccaacctgatgacgctgactggatagtcaccgcagatggcagccaccatgccctgacgctgagcaacgcccagccccagcacgcaggagaggtcacatttgcagcacgtgacgccgtggcctctgcacgcctctctgtgttggctctccctggtccccctgaagatgctgaagtagtgggtcgaagtgaccactctgtgaccctatcctgggtggctcccgtgagtgacggcggcggcggtctatgtggttatcgtgtggagatgaaggaggcatccacaggccagtggcagttgtgccatgagttggtacctggcccagagtgtgtggtggacggcctggtctctgggaagacctaccgcttccgagtggcagccgtgggtccggcaggagctggggagcctgtacatctgccccagatggtcaagatagcagagccaatggaacctaaaccagccccagccccagcccctgccctagccccaaccccagctccaatcccaaccccagccccagccccagccccagccccaaccccagccccaaccccaaccccagccccagccccagcccctgccccagccccagcaacacggcgagcagtggttggtgaagatgtgtgtctggagctggaagtggcagctgatgctggcgaggtcgtctggcacaagggaacagagcgcatccatcccagtgggcactttgaggtcctctctcagggtcagcggcagatgctggtgatcaagggctttaggaccgaagaccagggggagtaccgctgtggtcccatccagggcctgccctcctcaggagcttctactttcaatgtggtcgtgacctcgggctcggaggatgaggtccctgcacagcccagcctgcctcccgaggcagcccaggagggtgacctgcatctgctttgggaggcccttgctcggaagcgtcgcatgagccgggagcccacgctggactccatcagtgagctgcccgaggaagacagccgtgtgcagcatctgcggcaggaggcagaagaggcggctcctgacctctctgagggctactccacagccgatgagctcgcacgcacaggagaagctgacctctcacacaccagctctgatgacgagtctcgggctggcaccccttccctaattacctacctcaagaaggccgggggtcctgggatctcacccttggccagcaagcatgaggcccaggtggccacgtctgtgaagccacaaaagcagcaggagcgggttgtgcccacatgcccactgccgggagatttgaacgcagcagatttgaaggatccatccctggacaaggccgctgtgaagatccaggctgcctttaagggctacaaagtgaggaaggagatgaagcagcagggaggccccgtgttctcacggacatttggggacacagaggcacaggttggggatgcgctgcggctggagtgtgtggtgtccaccaaggctgacgtgcgggcctgctggttgaaggatggcgtagagttaacagatgggcgccattaccacatagaccagctcaaggacggtacctgctctctgctggtcactggcctgggccccactgactctggtcgctacacctgtcaggtgagcaccaagtttggaagcgtgagccacagtgcctgcgtaatggtcagtgggacagaaagtgaggctgagagctcctcaggaggtgagctggacgatgccttccgccgggcagcacgacgcctgcatcgtctcttccgaaccaagagcccagctgagctttcagaagaggagctcttcctcagtgctgacgaaggccccatggagccagaggagcctgcagactggcaaacataccgagaggatgaaaactttgtgtgcatccgttttgagtcacttgcagaggcccaccgggcagtcacctgcttccgtgacatgtttgccaccatgggcatcggggtggagatcagcctaggggagcaggggccccggggagtggagatgcgcattggcaaggtggcccccactgtcatccctgcggtgccacttgcaaagacacctggcctgcagacttcagatgctgccccagtgttcctgacggagctgcagaaccaagacgtgcaggacggataccccatgagcttcgactgcgtggtaacaggccagcctgtgcccagtgtgcgctggttcaaggacgggaagttgctagaagaggatgaccactacatgatcaacgaggaccaacaggggggtcaccagctcatcatcacagccgtggtgccggcagacatgggagtgtaccgctgcctggcggagaacagcatgggcgtctcctccaccaaggctgagcttcgtgtggaattgaccagcacagactatgacactgctgctgatgctaccgagacctcatcctacttcagcgcccagggatacctgtccagccgggagcaagaggggacggagtcagatgaggggcagcttccccaggtgctggaggaactgaaagacctccaggtggcccctggcacacgcctggccaagttccagctcaaggtgaaaggttatccagctcccaaactgtactggttcaaagatggccagcccctgaccacatctgaccacatccgcatgactgacaaaaagaccctgcacaccctggagattgtctccatcacccgagaggacagcggccagtacgcggcctacatcagcaatgctgtgggtgccgcctattcgtcagcccggctgctggtccgaggtcccagtgaaccagaagagaagccacaaccagatgttcatgagaggctggtgccaccccgaatcctggagaagttcacccccaagaaagtgaagaggggctccagcatcaccttttcagtgaaggtggaaggacacccggcccccagtgtgcattggctcaaggaggaggcagagaagggagtcctgtggattggccctgatacccctggctacacgatggccagttcttccaagcaacatagcctggtcctgctggacgtaggccgacagcaccagggcacctacacgtgcattgccaccaatgctgctggccaggcgctctgctctgccagtctgcacatctctggcttggccaaagaagaggagcaggagagagtgaaggaggctctcatttcctccttcctgcaagggacgagccaagctgtctcagcccagatgtcagaatctgcaagttttgctgatcttgtcgggcaaaggaaaggtgagtccctggtggctgaggaggcccacagtcacctgtccctttctgaggtgggcacagaagagttcctgcagaaactcacctcacagatcaccgagatggtatcagccaagatctcgcaggccaaactccaggtgcctggaggtgacagtgatgaggagtctaagacaccatctgcttctcctcggcacggccggtcacgtccttcctccagtgttcaagagtcttcctcagagtcagaggatggagactcccgtggtgagatctttgacatctacgtggtcacagctgattatctgcccctgggagctgagcaggatgccatcatcctgagagaaggccagtatgtggaggtcctggactcagcccatcccctgcgctggcttgtacgcaccaagcccaccaaatccagcccttccaggcagggctgggtgtcacctgcctacctggacaagaggctcaagctatctcctgagtgggggcccactgaggcccctgagttccctggcgaggctgtgtctgaggatgagtatagaacgaggctgagctctgtcatccaggagttgctgagttcagagcaggcttttgtgggtgagttacagttcttggagagccaccacatcaagcacctggaccgatctccccgtgtacccgcagctgtggccagccagaagacggtcatctttcgtaatgtgcaggacatcagccatttccacagcagcttcttgaaggagctgcagagctgtggcaccgacgatgatgtagccatgtgcttcatcaagaaccaggaggcctttgagaagtaccttgagttcctggtgggccgggtgcaagcggaatcagtggtcgtcagcaccccagtccaggagttctacaagaaatatgcagaagagatgctgtcagccaaggaccccacacagccacccccacctcctcttcagcactacttggagcagccagtggaacgggtgcagaaataccaggccttgctgaaggagctaatccgcaacaaggctcgcaaccggcagaactgtgcgctgctggagcaggcctacgctgtggtgtctgccctgcctcagcgtgctgagaacaagctgcacgtttctctcatggagaactacccgggaaccctggaggccctgggagaacctatccgccagggtcacttcatagtgtgggagggggctccaggagcccggatgccttggaagggccacaaccggcatgtcttcctcttccgaaaccacctggtgatctgcaagccccggagagactctcgaacggacaccttcagctacgtgttccggaacatgatgaagctgaatagcatcgacctgaatgaccaggtagagggggatgaccgtgcctttgaggtgtggcacgagcgggaagactctgtccgcaagtacctgctgcaggcgcggacagtgatcatcaaaaactcatgggtgaaggagatctgtggcatccagcagcgccttgcccagcccgtgtggcgtccccctgagtttgaagaagaactagctgactgcacagccgagctgggtgaaacagtcaagctagcatgccgagtgactggcacacctaagcctattgtcagctggtacaaagatgggaagcccgtggaggtggacccacaccacatcctcattgaagaccctgatggctcctgtaccctcatcttggacaaccttactggcatagactctggccagtacatgtgttttgcggccagtgctgctggcaatgccagcaccttggggaagattctagtacaagtgcccccacgatttgtgaacaaggtccgagccacaccctttgtggagggagaggacgcgcagatcacctgcacagtggaaggagctccgtaccctcagatcaggtggtacaaggacggtgccctgctaaccctgggcaacaggtaccggatggtgaatgagccccgcagtggtatgctggtgctggtgatccaggcagccagcaaggaggacctgggacactatgaatgtgagttggtgaaccggttgggctcaacacgttgtggcggagaattatacatgcagagtcccgcactgcgtgcctgggaccagcaccaccgggaacagcttgtggctgctgtggaagacgcctccatggaggactctgcccaccccactcaggagggagctgaccaacaagccgcttctgtcctttggaggctgctgggctcagaagccctcagcccctccccagggggtttccccaacaccagacaaagtgagccacccacatcagaagaggctgctccccagatcccaggcacaacttcaggaacacctggcaaactcccagaggcttcacggcccggcacatacaaaggcctggagcaggggatgacaacaacttctggatcccaggaacggaatgtacccattcgggtggagggcacggcctggccaggcggaggcactgggcagctgctcttggatgtgcacagccaagtcatcatggagaccacacagaggacctatgtgtgccaagctcctgacacaggtgtcacaagggccccatccatgcaggtcactatcgaggacctacaagtacaagtgggtgacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtggaaggcctacactacctgcacagccatgatatcctccatctggacataaagccccccaacatcctgatggtccacccagctcgggaagacattaagatctgtgactttggctttgcccaaaagatcaccccgtcagagccacagtacagcaagtatggctcacctgaattcgtgtccccagagatcatcgagcagagtcctgtgagtgagggctcagacatctgggccatgggcgtcatctcctacctcagcctcacctgttcatccccattcgctggagagagtgaccgtgccaccctgctcaatgttttggaggggcgggtctcttggagcagtcccatggctgcccatctgagtgaggatgccaaggacttcatcaaggccacactgcaaaagacccccagggcccggcctagtgcttcccagtgccttgctcacccctggttcctgaagtccatgcctgctgaggaggcccacttcatcaacaccaaacagctcaagttccttcttgctcgcagtcgctggcagcgttccttgatgagctacaagtctatcctggtgatgcgctccatccctgagctgctccagggtcctccagacagtccatctctaggagtggcccggcacctacgaggggaagccagcggatcctctagctcatcgtcttcctcggacaatgagcttgccccatttgccagggctaagtcactgccaccttcccctgtcactcactcgccactgctgcaccctcggggctttctgcggccttcagccagcctcccggaggagacagaggccagcatgtccactgctgatgcagccatgccggcacccccccagagtgctgggcctccagcaagcccaggttgtgtgccccggcacagcgtcatcagcagcttgttctaccagcaagctggtgagggtgcagagcgtgggagcaaagcgttgggcgccaagaggcacccagctcggagacgccacctgctaaagggcgggtacattgcaagggccctgcccgggctacgagagccgctgatggagtttagtgtgttggaggaagaggctgctaatgaggagcaggcctctctgatgaccaagacaccctcctttgagaccgctctgcgactacctagttccaatgtcagagaggtcccaggccgaagccgctccctggacaacccaccaggcacagccagcccctctcctgaggcatacaaggaacaatacctgtccccaccctcctcggggttgactcatgaaaccaccgccaagggcatgggacacaaagaagggttcttgcaggagtctgtccccttttcacctaccagtggtgacctgaggcctgttaagcaagaggggtcatcccaggatagctgtagagggaaaccagcctcttcctgtcactctgaactgggttctggtccgcaggagggctgtggctctccatcatcacaattgtgtggctccttacctccacagtcatcgaagaaagagctctcaaaaccctgtggcccactcttttcagaacagcctcaggcagccccattcccagcgcaagcaagcccccttctgggttctcagaaggaacctcaggatagctatctacctgaaaagccatgtccagttccctccagttctccagggtcagcctcccaagtagatgcatccctggataccgaaggcttgtcggaagctggggacacatgtgacttcacgcctcctctccagcggcctcaggagcaggccaccacccggaagttctctctggaatcccgtgggggctatgcaggggtggcaggatatggcaccttcgcctttggtggggatgcaggggggatgttagggcagggtcccctttgggccaggatggcctgggctgtgtcccagtcctcagaagagcaagatgaagcagcgactgagagccctcaacctctggacagctcagggcccattgctgaggccagtggggttcccctaaggacctcgccaagcctcaccccatgggaggaagttgagcaggtttccctggtacagatccgggatctgtctggtgatgcagaagcagccgacaccatctccttggacatttcagaggtagatcctgcctacctcaacctctccgatctatatgacatcaagtatctcccgtttgagttcatgatcttcaggagggtccccaaacctgtagagcagccagagtcacctggctctgaaactgaagaggggcaagggctggcggagttcctggaggaggctgtgtggccctggccaggcgagctgggactgcgtgctggtctggagattacagaggagccacaggagccaggggacctggaagcactgctgggcgaggctgctgtgggcaggaagcgcaagtggtccccctcccgtggcctcttccaattccctgggaggtgcctgtcaggggaggagcccgtggagcttgggctgcgccagagggtgaaggcttccatggctcacatctccaggatcctgaagggcaagccggaaggtcctgagaaggaagggcctcccagaaagaaggcaggcctagcttctttccggctatcaggcctgaagggcagggaccaagcgccatccttcctaagagaactctctgatgaggctgtggtcctgggccaatcagtgacactggcctgccaggtgttggcccagccaactgcccaggctacctggagcaaagatggggcccttctggagagcagcggccacctcctcatctcttccaccctgaagaacttccagctgctgaccattctggtggtgacggaggaggatctgggcacatatacctgctgtgtgagcaacccactagggacagcagtcaccacaggtgtcctccggaaagcagagcgcccttcatcttctccacgcccggaggtgggggaactatacacggatgcagtgttgctggtctggaagcctgtggaatcctatggcccagtgacctacattgtgcagtgctgtatagaaggaggcagctggacaaccctggcctctgacatctccgactgctgctacctcactggcaagctgccccggggtggcatgtataccttccggacagcatgtgtcagcaaagcaggaatgggcccctacagtagcccctcagaacaggtcctccttggaggacccaaccacctggcttctgaggaggaaagcagccgggggagaccagcccagcttcttcccagcacaaagacttttgccttccagacacagatccggaggggccgcttcagtgtggtgaggcagtgtagggagaaagcaagtgggcgggccctggctgctaagatcgttccctaccagcctgaggacaagacaactgtactaagagaatatgaggcactaaagagactgcaccacccacatctggcccaactccatgctgcctacctcagtccccggcacctggtgctcatcctagagctgtgctctggccctgagctgctaccctctctggcggagagggactcgtactcagagtctgatgtgaaggactacctgtggcagatgctcagtgccacccagtacctgcatgcccaacacatcctgcacctggacctgaggtcggagaacatgatggtcaccgagtacaacctgcttaaggttatagacctgggtaacgcccagagtctcagccaagagaaggtcccacctcctgaaaacttcaaagactacctagagaccatggctccagaacttctggaaggccaaggggcggttccacagacagacatctgggctattggtgtaacagccttcattatgctgagtggcgagtacccagtgagcagcgaggggactcgcgacctgcagaaaggcctgcgcaagggactcattcaattgagtcgctgctatgcaggattatcagggggtgcggtagccttcctgcagagttcattgtgcgctcggccctggggtcgcccgtgcgcttccacctgcttgcagtgcgggtggctgacggaggagggccccaccggttcccggcccacgcccgtgaccttccccaccgcgcgattgcgtgcctttgtgcgcgagcgcgagaagcgccgggcgctactctacaagaagcacaacctggctcaggtgcgctgaggcccagccctacagagcaagatgtgcccgccaataaaagatgcaaaacagcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]