GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 11:26:32, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_039087254           14559 bp    mRNA    linear   ROD 21-JAN-2021
DEFINITION  PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and
            titin-interacting RhoGEF (Obscn), transcript variant X34, mRNA.
ACCESSION   XM_039087254
VERSION     XM_039087254.1
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051345.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rattus norvegicus Annotation Release
                                           108
            Annotation Version          :: 108
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..14559
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..14559
                     /gene="Obscn"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 23 ESTs, 2 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 6 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:338458"
                     /db_xref="RGD:631335"
     CDS             130..14505
                     /gene="Obscn"
                     /codon_start=1
                     /product="obscurin isoform X32"
                     /protein_id="XP_038943182.1"
                     /db_xref="GeneID:338458"
                     /db_xref="RGD:631335"
                     /translation="
MVTLRCQMSKVTPVEWRKGSETLRDGGRYSLRQDGAVCELQIHRLALEDAGEYSCLCGQEKTSATLSVKALPPRFIEDLRSQKATEGTMVTLRCQMSKVAPVEWRKGSESLRDGDRYSLRQDGAMCELQICGLAVEDSGEYSCVCGQERTSATLTVDALPPKFTEGLKKEEATEGNMATLRCQMSKAAPVEWRKGSETLRDGGRYSLRQDGAACELQIRGLALEDAGEYSCLCGQEKTSATLSVKALPPRFIEDLRSQEATEGNMVTLRCQMSKVTPVEWRKGSETLRDGGRYSLRQDGAVCELQIHRLALEDAGEYSCLCGQEKTSATLSVKALPPRFTEDLRSQKATEGTMVTLRCQMSKAAPVEWRKGSETLRDGGRYSLRQDGAVYELQIRGLALEDAGEYSCVCGQEKTSATLSVKALPARFIEDLRSQEVPESSTVTMRCELSKKAPVVWRKGSETLKNGARYSLRQDGAVCELEIRDLTVEDAGEYSCTCGKERTSATLSIMAPQVVFQKLLENLQAEEGSTASLRCELSVPNTAVVWSKGGLELQADTCRETRQQGCVAELLLRDVRREDAGEYSCTCGSQTTSATLMVTAAPVRFLQELQAQDVDEGTTARLRCELSREAASVEWRKGSLQLFPCAKYQMVQEGTTAELLVHGVEQEDAGEYTCDAGHMQSIARLSVRAPKPKFKTGLQSKEQEAGGTARLCCQLSEAESGTPVQWLKEGVELHVSSKYEMRCQGAMCELLIHKLEAKDTGEYACVVGGQKTLASLRVKEPEVTIVQGLVDMEVQADEDVEFTCKVSQAGATDVQWHLQGLPLQSNEVTEVAVLGDGCTHVLQLKGVTLDDAGTVSFHVGSHSSSAQLIVRVPEVTVLEPLKDVQLSEGQDAHFQCRLSRASGQEARWALGGVPLQCNEMNDITVEQGTLYSLTLHKVTLEDAGTITLQVGSCSSEAQLKVTEAALCLVRGLQNVDVFAGEVATFSCEVSRAGGPEARWWLDGTLLQNSPESAMTVREGTVHSLTLSGLGVADSGTITFRTGPLVSTAKLLVKDPTVEVVSAMQDLVVEEGGSAELLCQYSRPVQAMWKMNEREVCADGHRVIIEQDWTVARLTLRPALPCDSGIYSCEAAGTRVVALLQVQAKNTVVRGLENVDALEGGEALFECQLSQPEVAAHTWLLDDEPVHTSANVEVVYFENGLRHLLLLKNLKPQDSCRVTFLAGDVVTSAFLTVRGWRLEVLEPPQDASVKAGTQVCFTCILSEALPVGEATWYINGAAIQPDDADWIVTADGSHHALTLSNAQPQHAGEVTFAARDAVASARLSVLALPGPPEDAEVVGRSDHSVTLSWVAPVSDGGGGLCGYRVEMKEASTGQWQLCHELVPGPECVVDGLVSGKTYRFRVAAVGPAGAGEPVHLPQMVKIAEPMEPKPAPAPAPALAPTPAPIPTPAPAPAPAPTPAPTPTPAPAPAPAPAPATRRAVVGEDVCLELEVAADAGEVVWHKGTERIHPSGHFEVLSQGQRQMLVIKGFRTEDQGEYRCGPIQGLPSSGASTFNVVVTSGSEDEVPAQPSLPPEAAQEGDLHLLWEALARKRRMSREPTLDSISELPEEDSRVQHLRQEAEEAAPDLSEGYSTADELARTGEADLSHTSSDDESRAGTPSLITYLKKAGGPGISPLASKHEAQVATSVKPQKQQERVVPTCPLPGDLNAADLKDPSLDKAAVKIQAAFKGYKVRKEMKQQGGPVFSRTFGDTEAQVGDALRLECVVSTKADVRACWLKDGVELTDGRHYHIDQLKDGTCSLLVTGLGPTDSGRYTCQVSTKFGSVSHSACVMVSGTESEAESSSGGELDDAFRRAARRLHRLFRTKSPAELSEEELFLSADEGPMEPEEPADWQTYREDENFVCIRFESLAEAHRAVTCFRDMFATMGIGVEISLGEQGPRGVEMRIGKVAPTVIPAVPLAKTPGLQTSDAAPVFLTELQNQDVQDGYPMSFDCVVTGQPVPSVRWFKDGKLLEEDDHYMINEDQQGGHQLIITAVVPADMGVYRCLAENSMGVSSTKAELRVELTSTDYDTAADATETSSYFSAQGYLSSREQEGTESDEGQLPQVLEELKDLQVAPGTRLAKFQLKVKGYPAPKLYWFKDGQPLTTSDHIRMTDKKTLHTLEIVSITREDSGQYAAYISNAVGAAYSSARLLVRGPSEPEEKPQPDVHERLVPPRILEKFTPKKVKRGSSITFSVKVEGHPAPSVHWLKEEAEKGVLWIGPDTPGYTMASSSKQHSLVLLDVGRQHQGTYTCIATNAAGQALCSASLHISGLAKEEEQERVKEALISSFLQGTSQAVSAQMSESASFADLVGQRKGESLVAEEAHSHLSLSEVGTEEFLQKLTSQITEMVSAKISQAKLQVPGGDSDEESKTPSASPRHGRSRPSSSVQESSSESEDGDSRGEIFDIYVVTADYLPLGAEQDAIILREGQYVEVLDSAHPLRWLVRTKPTKSSPSRQGWVSPAYLDKRLKLSPEWGPTEAPEFPGEAVSEDEYRTRLSSVIQELLSSEQAFVGELQFLESHHIKHLDRSPRVPAAVASQKTVIFRNVQDISHFHSSFLKELQSCGTDDDVAMCFIKNQEAFEKYLEFLVGRVQAESVVVSTPVQEFYKKYAEEMLSAKDPTQPPPPPLQHYLEQPVERVQKYQALLKELIRNKARNRQNCALLEQAYAVVSALPQRAENKLHVSLMENYPGTLEALGEPIRQGHFIVWEGAPGARMPWKGHNRHVFLFRNHLVICKPRRDSRTDTFSYVFRNMMKLNSIDLNDQVEGDDRAFEVWHEREDSVRKYLLQARTVIIKNSWVKEICGIQQRLAQPVWRPPEFEEELADCTAELGETVKLACRVTGTPKPIVSWYKDGKPVEVDPHHILIEDPDGSCTLILDNLTGIDSGQYMCFAASAAGNASTLGKILVQVPPRFVNKVRATPFVEGEDAQITCTVEGAPYPQIRWYKDGALLTLGNRYRMVNEPRSGMLVLVIQAASKEDLGHYECELVNRLGSTRCGGELYMQSPALRAWDQHHREQLVAAVEDASMEDSAHPTQEGADQQAASVLWRLLGSEALSPSPGGFPNTRQSEPPTSEEAAPQIPGTTSGTPGKLPEASRPGTYKGLEQGMTTTSGSQERNVPIRVEGTAWPGGGTGQLLLDVHSQVIMETTQRTYVCQAPDTGVTRAPSMQVTIEDLQVQVGDMAQFDAVIEGNPPPTVTWYKDSNQLVNGTRLRQQQGGTTYSLVLMDVTPHDAGVYTCVAQNAGGQVLCKAELLVYGGDKSDAEKQAYRRKLHSFYEVQEEIGRGVFGFVKRVQHKGNKMSCAAKFIPLRSKTRAQAYQERDILATLSHPLVTGLLDQFETQKTLILILELCSSEELLDRLFKKAVVTEAEVKVYIQQLVEGLHYLHSHDILHLDIKPPNILMVHPAREDIKICDFGFAQKITPSEPQYSKYGSPEFVSPEIIEQSPVSEGSDIWAMGVISYLSLTCSSPFAGESDRATLLNVLEGRVSWSSPMAAHLSEDAKDFIKATLQKTPRARPSASQCLAHPWFLKSMPAEEAHFINTKQLKFLLARSRWQRSLMSYKSILVMRSIPELLQGPPDSPSLGVARHLRGEASGSSSSSSSSDNELAPFARAKSLPPSPVTHSPLLHPRGFLRPSASLPEETEASMSTADAAMPAPPQSAGPPASPGCVPRHSVISSLFYQQAGEGAERGSKALGAKRHPARRRHLLKGGYIARALPGLREPLMEFSVLEEEAANEEQASLMTKTPSFETALRLPSSNVREVPGRSRSLDNPPGTASPSPEAYKEQYLSPPSSGLTHETTAKGMGHKEGFLQESVPFSPTSGDLRPVKQEGSSQDSCRGKPASSCHSELGSGPQEGCGSPSSQLCGSLPPQSSKKELSKPCGPLFSEQPQAAPFPAQASPLLGSQKEPQDSYLPEKPCPVPSSSPGSASQVDASLDTEGLSEAGDTCDFTPPLQRPQEQATTRKFSLESRGGYAGVAGYGTFAFGGDAGGMLGQGPLWARMAWAVSQSSEEQDEAATESPQPLDSSGPIAEASGVPLRTSPSLTPWEEVEQVSLVQIRDLSGDAEAADTISLDISEVDPAYLNLSDLYDIKYLPFEFMIFRRVPKPVEQPESPGSETEEGQGLAEFLEEAVWPWPGELGLRAGLEITEEPQEPGDLEALLGEAAVGRKRKWSPSRGLFQFPGRCLSGEEPVELGLRQRVKASMAHISRILKGKPEGPEKEGPPRKKAGLASFRLSGLKGRDQAPSFLRELSDEAVVLGQSVTLACQVLAQPTAQATWSKDGALLESSGHLLISSTLKNFQLLTILVVTEEDLGTYTCCVSNPLGTAVTTGVLRKAERPSSSPRPEVGELYTDAVLLVWKPVESYGPVTYIVQCCIEGGSWTTLASDISDCCYLTGKLPRGGMYTFRTACVSKAGMGPYSSPSEQVLLGGPNHLASEEESSRGRPAQLLPSTKTFAFQTQIRRGRFSVVRQCREKASGRALAAKIVPYQPEDKTTVLREYEALKRLHHPHLAQLHAAYLSPRHLVLILELCSGPELLPSLAERDSYSESDVKDYLWQMLSATQYLHAQHILHLDLRSENMMVTEYNLLKVIDLGNAQSLSQEKVPPPENFKDYLETMAPELLEGQGAVPQTDIWAIGVTAFIMLSGEYPVSSEGTRDLQKGLRKGLIQLSRCYAGLSGGAVAFLQSSLCARPWGRPCASTCLQCGWLTEEGPTGSRPTPVTFPTARLRAFVREREKRRALLYKKHNLAQVR"
     misc_feature    133..333
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    133..147
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    169..180
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    241..255
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    346..597
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    346..354
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    358..378
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    397..420
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    433..447
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    475..489
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    502..525
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    565..597
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    610..861
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    658..678
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    694..711
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    718..729
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    742..759
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    766..783
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    808..828
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    835..861
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    871..882
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    874..1125
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    889..903
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    925..951
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    979..990
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1006..1023
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1030..1047
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1093..1125
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1138..1389
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1162..1176
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    1186..1206
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1222..1239
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1246..1257
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1270..1287
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1294..1311
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1336..1356
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1363..1389
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1405..1653
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1414..1434
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    1453..1476
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1489..1503
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1507..1518
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1531..1545
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1558..1581
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1669..1920
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1675..1683
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    1690..1704
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    1714..1734
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1753..1770
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1777..1788
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1801..1818
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1825..1842
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1867..1887
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1894..1920
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1936..2187
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1981..2001
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2020..2037
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2044..2055
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2068..2085
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    2092..2109
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2134..2154
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    2161..2187
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2236..2460
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2248..2268
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2293..2310
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2317..2328
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2341..2358
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    2365..2382
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2407..2427
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    2434..2460
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2479..2736
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2524..2538
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2563..2577
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2638..2658
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2743..3009
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2767..2784
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    2797..2820
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2839..2859
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2860..2871
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2887..2907
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    2914..2946
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2974..3009
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    3031..3246
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3040..3057
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    3070..3093
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3112..3132
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3133..3144
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    3160..3180
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    3187..3219
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3316..3516
                     /gene="Obscn"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:214653"
     misc_feature    3346..3360
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3379..3393
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3457..3471
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3499..3516
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3565..3822
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3838..4098
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3853..3870
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    3883..3906
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3928..3948
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3949..3960
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    3976..3996
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    4003..4035
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    4045..4071
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    4108..4365
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:238020"
     misc_feature    order(4108..4110,4303..4305,4348..4350)
                     /gene="Obscn"
                     /note="Interdomain contacts [active]"
                     /db_xref="CDD:238020"
     misc_feature    order(4351..4356,4360..4365)
                     /gene="Obscn"
                     /note="Cytokine receptor motif [active]"
                     /db_xref="CDD:238020"
     misc_feature    4555..4740
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    4573..4593
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4612..4629
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4636..4647
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    4660..4677
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    4684..4701
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5350..5622
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    5359..5370
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    5374..5385
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    5395..5424
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5437..5457
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5464..5472
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    5488..5505
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    5512..5538
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5560..5583
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5590..5622
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6040..6312
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    6040..6051
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    6058..6075
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    6088..6111
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6130..6150
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6151..6162
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    6178..6198
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6205..6237
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6247..6273
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6277..6312
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6436..6708
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    6451..6465
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    6487..6516
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6529..6546
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6553..6561
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    6577..6594
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6601..6618
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6643..6669
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6676..6708
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6769..7056
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    6769..6777
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    6781..6801
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    6820..6843
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6859..6876
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6880..6891
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    6913..6936
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6949..6972
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6991..7017
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    7462..7650
                     /gene="Obscn"
                     /note="Src homology 3 domain of Obscurin and similar
                     proteins; Region: SH3_Obscurin_like; cd12025"
                     /db_xref="CDD:212958"
     misc_feature    order(7483..7485,7489..7491,7498..7500,7516..7518,
                     7570..7575,7630..7632,7636..7641)
                     /gene="Obscn"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212958"
     misc_feature    7747..8277
                     /gene="Obscn"
                     /note="Guanine nucleotide exchange factor for
                     Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous
                     (DH) domain. It appears that PH domains invariably occur
                     C-terminal to RhoGEF/DH domains; Region: RhoGEF; cl02571"
                     /db_xref="CDD:413383"
     misc_feature    order(7756..7758,7768..7770,8134..8139,8146..8151,
                     8155..8160,8167..8172,8179..8184,8191..8193,8269..8271)
                     /gene="Obscn"
                     /note="GTPase interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238091"
     misc_feature    8302..8676
                     /gene="Obscn"
                     /note="Obscurin pleckstrin homology (PH) domain; Region:
                     PH_Obscurin; cd13239"
                     /db_xref="CDD:270059"
     misc_feature    8698..8970
                     /gene="Obscn"
                     /note="First immunoglobulin-like domains A168 within the
                     A-band segment of human cardiac titin, and similar
                     domains; a member of the I-set of IgSF domains; Region:
                     IgI_1_Titin-A168_like; cd20971"
                     /db_xref="CDD:409563"
     misc_feature    8749..8763
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409563"
     misc_feature    8788..8802
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409563"
     misc_feature    8869..8883
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409563"
     misc_feature    8908..8925
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409563"
     misc_feature    8947..8958
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409563"
     misc_feature    8977..9216
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig_3; pfam13927"
                     /db_xref="CDD:404760"
     misc_feature    8977..8988
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    8995..9009
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    9031..9057
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    9070..9087
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    9094..9102
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    9118..9135
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    9148..9165
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    9190..9216
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9223..9255
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    9742..10011
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    9790..9813
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    9832..9852
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    9853..9864
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    9901..9936
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    9946..9972
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9976..10011
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    10063..10833
                     /gene="Obscn"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:419665"
     misc_feature    order(10090..10104,10108..10110,10114..10116,10153..10155,
                     10159..10161,10243..10245,10291..10296,10300..10302,
                     10312..10314,10318..10320,10429..10431,10435..10437,
                     10441..10446,10450..10452,10486..10491,10498..10500,
                     10543..10554)
                     /gene="Obscn"
                     /note="active site"
                     /db_xref="CDD:270870"
     misc_feature    order(10090..10104,10108..10110,10114..10116,10153..10155,
                     10159..10161,10243..10245,10291..10296,10300..10302,
                     10312..10314,10441..10446,10450..10452,10486..10491)
                     /gene="Obscn"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(10102..10104,10312..10314,10318..10320,10429..10431,
                     10435..10437,10441..10443,10498..10500,10543..10554)
                     /gene="Obscn"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    10486..10554
                     /gene="Obscn"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270870"
     misc_feature    12982..13230
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    13033..13047
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    13072..13086
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    13147..13164
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    13192..13209
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    13234..13245
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    13264..13500
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; Region: FN3; smart00060"
                     /db_xref="CDD:214495"
     misc_feature    13600..14370
                     /gene="Obscn"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:419665"
     misc_feature    order(13630..13644,13648..13650,13654..13656,13693..13695,
                     13699..13701,13783..13785,13831..13836,13840..13842,
                     13852..13854,13858..13860,13969..13971,13975..13977,
                     13981..13986,13990..13992,14020..14025,14032..14034,
                     14083..14094)
                     /gene="Obscn"
                     /note="active site"
                     /db_xref="CDD:270870"
     misc_feature    order(13630..13644,13648..13650,13654..13656,13693..13695,
                     13699..13701,13783..13785,13831..13836,13840..13842,
                     13852..13854,13981..13986,13990..13992,14020..14025)
                     /gene="Obscn"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(13642..13644,13852..13854,13858..13860,13969..13971,
                     13975..13977,13981..13983,14032..14034,14083..14094)
                     /gene="Obscn"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    14020..14094
                     /gene="Obscn"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270870"
ORIGIN      
ttctggaagatgctggggagtactcatgcgtgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgcccccccagattcacagaagacttgaaaagccaagaggccacagaaggcaccatggtaactctaaggtgccagatgagcaaggtgacccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgcctcccagattcatagaagacttgagaagccaaaaggccacagaaggcaccatggtgactctgaggtgccagatgagcaaggtggcccctgtggagtggaggaaggggtctgagagcctgagagatggggacagatacagcctgaggcaggatggggccatgtgtgagctgcagatctgtggcctggctgtagaagacagtggggagtactcgtgcgtgtgtgggcaggagaggacatcagccacactgactgtagatgcactgccccccaagttcacagagggtctgaaaaaggaagaggccacagaagggaacatggcgactctgaggtgccagatgagcaaggcggcccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgcgtgtgagctgcagatccgtggtctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcatagaagacttgagaagccaagaggccacagaagggaacatggtgactctaaggtgccagatgagcaaggtgacccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcacagaagacttgagaagccaaaaagccacggaaggcaccatggtgactttaaggtgccagatgagcaaggcagcccctgtggagtggaggaaggggtctgagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtatgagctgcagatccgaggcttggctctggaagatgctggggagtactcatgtgtgtgtgggcaggagaagacctcagccacactgagtgtcaaggcccttccagccagattcatagaagatttgagaagccaagaggtcccggaaagttcaacagtcacaatgcggtgtgagctaagcaagaaggcccctgtggtgtggaggaaagggtctgagaccctgaaaaatggggccaggtacagcctgagacaggatggtgctgtgtgtgagctggagatccgtgacctgactgtggaagatgctggagagtactcatgcacatgtgggaaggagaggacctcagccacactgagcattatggctccacaggtggtgttccagaagttactggagaatctgcaagcagaagaaggctccacagccagcctgcggtgtgagctgtcagtccccaacactgctgtggtctggagcaagggcggcctggagctgcaggctgacacatgccgagagacacggcagcagggctgcgttgcagaactgctgcttagggacgtgcgccgtgaggacgcgggcgagtacagctgtacctgtggttcccagaccacaagtgccacactcatggtcacagctgctcctgtgaggttcctccaggagctacaggcccaggacgtagatgaagggaccaccgcacgcctgcgctgtgagctgagccgggaggctgcgagtgtggaatggcgcaagggctccttgcagctttttccttgtgctaagtatcagatggtgcaggagggcacaactgcagagctgctagtccatggggtggagcaggaggatgcaggggaatacacctgcgatgcaggacacatgcagagcattgccaggctctccgtccgagcccccaagcccaagttcaagaccggcctacagagcaaagagcaagaagcaggtggcacagcacggctgtgttgtcaactgagcgaagctgagtcggggactccagtacaatggctcaaagagggggtggagctgcatgtcagctccaagtacgagatgcggtgccaaggggctatgtgtgagttgctgatccacaagctggaggccaaggacactggtgaatatgcctgcgtggtgggtggccagaagaccttggcctccctcagagtcaaagagcctgaggtgaccattgtgcagggactggtggacatggaggtgcaggctgatgaggatgtggagttcacttgcaaggtgtcacaggcaggagccacagatgtgcagtggcatctccaaggtctgccactgcagagcaatgaagtgacagaggtggctgttcttggagacggctgtacccatgtgctccagttgaagggtgtgacactggatgatgctggtactgtctccttccacgtgggcagccattcatcttctgctcagctcatagtccgagtccccgaggtgaccgttctggagcccctgaaggatgtgcagctcagcgagggccaggatgcccatttccagtgccggctgtccagggcttcgggccaggaggctcgctgggctttgggaggagttcccttgcagtgcaatgagatgaatgacatcactgtggagcagggcacactctactcgctcactctgcacaaggtgaccctcgaggatgccggaaccatcactctccaagtgggctcatgctcctcagaggcccagctgaaggtcacagaggcagcactgtgcctggtacgaggcttgcagaatgtggatgtcttcgcgggggaggtggccacgttctcctgtgaggtatctcgagcaggtgggccagaggcccgctggtggctggatggcaccctgcttcagaacagccctgagagtgccatgactgtacgagagggtactgttcactccctcacgctctcgggcctgggggtggctgactcaggcaccatcaccttccgcacggggcccctggtctccacagccaagttattggtcaaagatcccacagtggaggtggtgagtgccatgcaggacctggtggtggaggagggtggctcggccgagctcctctgccagtactcgcggcccgtgcaggccatgtggaagatgaacgagcgggaggtgtgcgcggatgggcaccgtgtcatcatagagcaggactggaccgtagccaggctgaccctcaggccggccctgccctgtgacagtggcatctattcttgtgaggctgcgggcactcgagttgtggcactgctccaagtgcaagccaagaacacagtggtgcgtggcctggagaatgtggatgcactggagggcggcgaagctctgttcgagtgtcagctgtcccagccggaagtggctgcccacacctggttactagacgatgagcctgtgcacacatcagcaaacgtggaggtggtctactttgagaacggactgcgccacttgcttttgctcaaaaacctgaagccacaggacagctgccgagtgaccttcctggcaggggacgtggtcacgtctgccttcctcactgtgagaggctggcgcttggaggtcctggagcccccacaagacgcatctgtgaaagctggtacgcaggtctgcttcacttgcatactaagtgaggccctgcctgtgggcgaggctacttggtacatcaacggggctgccatccaacctgatgacgctgactggatagtcaccgcagatggcagccaccatgccctgacgctgagcaacgcccagccccagcacgcaggagaggtcacatttgcagcacgtgacgccgtggcctctgcacgcctctctgtgttggctctccctggtccccctgaagatgctgaagtagtgggtcgaagtgaccactctgtgaccctatcctgggtggctcccgtgagtgacggcggcggcggtctatgtggttatcgtgtggagatgaaggaggcatccacaggccagtggcagttgtgccatgagttggtacctggcccagagtgtgtggtggacggcctggtctctgggaagacctaccgcttccgagtggcagccgtgggtccggcaggagctggggagcctgtacatctgccccagatggtcaagatagcagagccaatggaacctaaaccagccccagccccagcccctgccctagccccaaccccagctccaatcccaaccccagccccagccccagccccagccccaaccccagccccaaccccaaccccagccccagccccagcccctgccccagccccagcaacacggcgagcagtggttggtgaagatgtgtgtctggagctggaagtggcagctgatgctggcgaggtcgtctggcacaagggaacagagcgcatccatcccagtgggcactttgaggtcctctctcagggtcagcggcagatgctggtgatcaagggctttaggaccgaagaccagggggagtaccgctgtggtcccatccagggcctgccctcctcaggagcttctactttcaatgtggtcgtgacctcgggctcggaggatgaggtccctgcacagcccagcctgcctcccgaggcagcccaggagggtgacctgcatctgctttgggaggcccttgctcggaagcgtcgcatgagccgggagcccacgctggactccatcagtgagctgcccgaggaagacagccgtgtgcagcatctgcggcaggaggcagaagaggcggctcctgacctctctgagggctactccacagccgatgagctcgcacgcacaggagaagctgacctctcacacaccagctctgatgacgagtctcgggctggcaccccttccctaattacctacctcaagaaggccgggggtcctgggatctcacccttggccagcaagcatgaggcccaggtggccacgtctgtgaagccacaaaagcagcaggagcgggttgtgcccacatgcccactgccgggagatttgaacgcagcagatttgaaggatccatccctggacaaggccgctgtgaagatccaggctgcctttaagggctacaaagtgaggaaggagatgaagcagcagggaggccccgtgttctcacggacatttggggacacagaggcacaggttggggatgcgctgcggctggagtgtgtggtgtccaccaaggctgacgtgcgggcctgctggttgaaggatggcgtagagttaacagatgggcgccattaccacatagaccagctcaaggacggtacctgctctctgctggtcactggcctgggccccactgactctggtcgctacacctgtcaggtgagcaccaagtttggaagcgtgagccacagtgcctgcgtaatggtcagtgggacagaaagtgaggctgagagctcctcaggaggtgagctggacgatgccttccgccgggcagcacgacgcctgcatcgtctcttccgaaccaagagcccagctgagctttcagaagaggagctcttcctcagtgctgacgaaggccccatggagccagaggagcctgcagactggcaaacataccgagaggatgaaaactttgtgtgcatccgttttgagtcacttgcagaggcccaccgggcagtcacctgcttccgtgacatgtttgccaccatgggcatcggggtggagatcagcctaggggagcaggggccccggggagtggagatgcgcattggcaaggtggcccccactgtcatccctgcggtgccacttgcaaagacacctggcctgcagacttcagatgctgccccagtgttcctgacggagctgcagaaccaagacgtgcaggacggataccccatgagcttcgactgcgtggtaacaggccagcctgtgcccagtgtgcgctggttcaaggacgggaagttgctagaagaggatgaccactacatgatcaacgaggaccaacaggggggtcaccagctcatcatcacagccgtggtgccggcagacatgggagtgtaccgctgcctggcggagaacagcatgggcgtctcctccaccaaggctgagcttcgtgtggaattgaccagcacagactatgacactgctgctgatgctaccgagacctcatcctacttcagcgcccagggatacctgtccagccgggagcaagaggggacggagtcagatgaggggcagcttccccaggtgctggaggaactgaaagacctccaggtggcccctggcacacgcctggccaagttccagctcaaggtgaaaggttatccagctcccaaactgtactggttcaaagatggccagcccctgaccacatctgaccacatccgcatgactgacaaaaagaccctgcacaccctggagattgtctccatcacccgagaggacagcggccagtacgcggcctacatcagcaatgctgtgggtgccgcctattcgtcagcccggctgctggtccgaggtcccagtgaaccagaagagaagccacaaccagatgttcatgagaggctggtgccaccccgaatcctggagaagttcacccccaagaaagtgaagaggggctccagcatcaccttttcagtgaaggtggaaggacacccggcccccagtgtgcattggctcaaggaggaggcagagaagggagtcctgtggattggccctgatacccctggctacacgatggccagttcttccaagcaacatagcctggtcctgctggacgtaggccgacagcaccagggcacctacacgtgcattgccaccaatgctgctggccaggcgctctgctctgccagtctgcacatctctggcttggccaaagaagaggagcaggagagagtgaaggaggctctcatttcctccttcctgcaagggacgagccaagctgtctcagcccagatgtcagaatctgcaagttttgctgatcttgtcgggcaaaggaaaggtgagtccctggtggctgaggaggcccacagtcacctgtccctttctgaggtgggcacagaagagttcctgcagaaactcacctcacagatcaccgagatggtatcagccaagatctcgcaggccaaactccaggtgcctggaggtgacagtgatgaggagtctaagacaccatctgcttctcctcggcacggccggtcacgtccttcctccagtgttcaagagtcttcctcagagtcagaggatggagactcccgtggtgagatctttgacatctacgtggtcacagctgattatctgcccctgggagctgagcaggatgccatcatcctgagagaaggccagtatgtggaggtcctggactcagcccatcccctgcgctggcttgtacgcaccaagcccaccaaatccagcccttccaggcagggctgggtgtcacctgcctacctggacaagaggctcaagctatctcctgagtgggggcccactgaggcccctgagttccctggcgaggctgtgtctgaggatgagtatagaacgaggctgagctctgtcatccaggagttgctgagttcagagcaggcttttgtgggtgagttacagttcttggagagccaccacatcaagcacctggaccgatctccccgtgtacccgcagctgtggccagccagaagacggtcatctttcgtaatgtgcaggacatcagccatttccacagcagcttcttgaaggagctgcagagctgtggcaccgacgatgatgtagccatgtgcttcatcaagaaccaggaggcctttgagaagtaccttgagttcctggtgggccgggtgcaagcggaatcagtggtcgtcagcaccccagtccaggagttctacaagaaatatgcagaagagatgctgtcagccaaggaccccacacagccacccccacctcctcttcagcactacttggagcagccagtggaacgggtgcagaaataccaggccttgctgaaggagctaatccgcaacaaggctcgcaaccggcagaactgtgcgctgctggagcaggcctacgctgtggtgtctgccctgcctcagcgtgctgagaacaagctgcacgtttctctcatggagaactacccgggaaccctggaggccctgggagaacctatccgccagggtcacttcatagtgtgggagggggctccaggagcccggatgccttggaagggccacaaccggcatgtcttcctcttccgaaaccacctggtgatctgcaagccccggagagactctcgaacggacaccttcagctacgtgttccggaacatgatgaagctgaatagcatcgacctgaatgaccaggtagagggggatgaccgtgcctttgaggtgtggcacgagcgggaagactctgtccgcaagtacctgctgcaggcgcggacagtgatcatcaaaaactcatgggtgaaggagatctgtggcatccagcagcgccttgcccagcccgtgtggcgtccccctgagtttgaagaagaactagctgactgcacagccgagctgggtgaaacagtcaagctagcatgccgagtgactggcacacctaagcctattgtcagctggtacaaagatgggaagcccgtggaggtggacccacaccacatcctcattgaagaccctgatggctcctgtaccctcatcttggacaaccttactggcatagactctggccagtacatgtgttttgcggccagtgctgctggcaatgccagcaccttggggaagattctagtacaagtgcccccacgatttgtgaacaaggtccgagccacaccctttgtggagggagaggacgcgcagatcacctgcacagtggaaggagctccgtaccctcagatcaggtggtacaaggacggtgccctgctaaccctgggcaacaggtaccggatggtgaatgagccccgcagtggtatgctggtgctggtgatccaggcagccagcaaggaggacctgggacactatgaatgtgagttggtgaaccggttgggctcaacacgttgtggcggagaattatacatgcagagtcccgcactgcgtgcctgggaccagcaccaccgggaacagcttgtggctgctgtggaagacgcctccatggaggactctgcccaccccactcaggagggagctgaccaacaagccgcttctgtcctttggaggctgctgggctcagaagccctcagcccctccccagggggtttccccaacaccagacaaagtgagccacccacatcagaagaggctgctccccagatcccaggcacaacttcaggaacacctggcaaactcccagaggcttcacggcccggcacatacaaaggcctggagcaggggatgacaacaacttctggatcccaggaacggaatgtacccattcgggtggagggcacggcctggccaggcggaggcactgggcagctgctcttggatgtgcacagccaagtcatcatggagaccacacagaggacctatgtgtgccaagctcctgacacaggtgtcacaagggccccatccatgcaggtcactatcgaggacctacaagtacaagtgggtgacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtggaaggcctacactacctgcacagccatgatatcctccatctggacataaagccccccaacatcctgatggtccacccagctcgggaagacattaagatctgtgactttggctttgcccaaaagatcaccccgtcagagccacagtacagcaagtatggctcacctgaattcgtgtccccagagatcatcgagcagagtcctgtgagtgagggctcagacatctgggccatgggcgtcatctcctacctcagcctcacctgttcatccccattcgctggagagagtgaccgtgccaccctgctcaatgttttggaggggcgggtctcttggagcagtcccatggctgcccatctgagtgaggatgccaaggacttcatcaaggccacactgcaaaagacccccagggcccggcctagtgcttcccagtgccttgctcacccctggttcctgaagtccatgcctgctgaggaggcccacttcatcaacaccaaacagctcaagttccttcttgctcgcagtcgctggcagcgttccttgatgagctacaagtctatcctggtgatgcgctccatccctgagctgctccagggtcctccagacagtccatctctaggagtggcccggcacctacgaggggaagccagcggatcctctagctcatcgtcttcctcggacaatgagcttgccccatttgccagggctaagtcactgccaccttcccctgtcactcactcgccactgctgcaccctcggggctttctgcggccttcagccagcctcccggaggagacagaggccagcatgtccactgctgatgcagccatgccggcacccccccagagtgctgggcctccagcaagcccaggttgtgtgccccggcacagcgtcatcagcagcttgttctaccagcaagctggtgagggtgcagagcgtgggagcaaagcgttgggcgccaagaggcacccagctcggagacgccacctgctaaagggcgggtacattgcaagggccctgcccgggctacgagagccgctgatggagtttagtgtgttggaggaagaggctgctaatgaggagcaggcctctctgatgaccaagacaccctcctttgagaccgctctgcgactacctagttccaatgtcagagaggtcccaggccgaagccgctccctggacaacccaccaggcacagccagcccctctcctgaggcatacaaggaacaatacctgtccccaccctcctcggggttgactcatgaaaccaccgccaagggcatgggacacaaagaagggttcttgcaggagtctgtccccttttcacctaccagtggtgacctgaggcctgttaagcaagaggggtcatcccaggatagctgtagagggaaaccagcctcttcctgtcactctgaactgggttctggtccgcaggagggctgtggctctccatcatcacaattgtgtggctccttacctccacagtcatcgaagaaagagctctcaaaaccctgtggcccactcttttcagaacagcctcaggcagccccattcccagcgcaagcaagcccccttctgggttctcagaaggaacctcaggatagctatctacctgaaaagccatgtccagttccctccagttctccagggtcagcctcccaagtagatgcatccctggataccgaaggcttgtcggaagctggggacacatgtgacttcacgcctcctctccagcggcctcaggagcaggccaccacccggaagttctctctggaatcccgtgggggctatgcaggggtggcaggatatggcaccttcgcctttggtggggatgcaggggggatgttagggcagggtcccctttgggccaggatggcctgggctgtgtcccagtcctcagaagagcaagatgaagcagcgactgagagccctcaacctctggacagctcagggcccattgctgaggccagtggggttcccctaaggacctcgccaagcctcaccccatgggaggaagttgagcaggtttccctggtacagatccgggatctgtctggtgatgcagaagcagccgacaccatctccttggacatttcagaggtagatcctgcctacctcaacctctccgatctatatgacatcaagtatctcccgtttgagttcatgatcttcaggagggtccccaaacctgtagagcagccagagtcacctggctctgaaactgaagaggggcaagggctggcggagttcctggaggaggctgtgtggccctggccaggcgagctgggactgcgtgctggtctggagattacagaggagccacaggagccaggggacctggaagcactgctgggcgaggctgctgtgggcaggaagcgcaagtggtccccctcccgtggcctcttccaattccctgggaggtgcctgtcaggggaggagcccgtggagcttgggctgcgccagagggtgaaggcttccatggctcacatctccaggatcctgaagggcaagccggaaggtcctgagaaggaagggcctcccagaaagaaggcaggcctagcttctttccggctatcaggcctgaagggcagggaccaagcgccatccttcctaagagaactctctgatgaggctgtggtcctgggccaatcagtgacactggcctgccaggtgttggcccagccaactgcccaggctacctggagcaaagatggggcccttctggagagcagcggccacctcctcatctcttccaccctgaagaacttccagctgctgaccattctggtggtgacggaggaggatctgggcacatatacctgctgtgtgagcaacccactagggacagcagtcaccacaggtgtcctccggaaagcagagcgcccttcatcttctccacgcccggaggtgggggaactatacacggatgcagtgttgctggtctggaagcctgtggaatcctatggcccagtgacctacattgtgcagtgctgtatagaaggaggcagctggacaaccctggcctctgacatctccgactgctgctacctcactggcaagctgccccggggtggcatgtataccttccggacagcatgtgtcagcaaagcaggaatgggcccctacagtagcccctcagaacaggtcctccttggaggacccaaccacctggcttctgaggaggaaagcagccgggggagaccagcccagcttcttcccagcacaaagacttttgccttccagacacagatccggaggggccgcttcagtgtggtgaggcagtgtagggagaaagcaagtgggcgggccctggctgctaagatcgttccctaccagcctgaggacaagacaactgtactaagagaatatgaggcactaaagagactgcaccacccacatctggcccaactccatgctgcctacctcagtccccggcacctggtgctcatcctagagctgtgctctggccctgagctgctaccctctctggcggagagggactcgtactcagagtctgatgtgaaggactacctgtggcagatgctcagtgccacccagtacctgcatgcccaacacatcctgcacctggacctgaggtcggagaacatgatggtcaccgagtacaacctgcttaaggttatagacctgggtaacgcccagagtctcagccaagagaaggtcccacctcctgaaaacttcaaagactacctagagaccatggctccagaacttctggaaggccaaggggcggttccacagacagacatctgggctattggtgtaacagccttcattatgctgagtggcgagtacccagtgagcagcgaggggactcgcgacctgcagaaaggcctgcgcaagggactcattcaattgagtcgctgctatgcaggattatcagggggtgcggtagccttcctgcagagttcattgtgcgctcggccctggggtcgcccgtgcgcttccacctgcttgcagtgcgggtggctgacggaggagggccccaccggttcccggcccacgcccgtgaccttccccaccgcgcgattgcgtgcctttgtgcgcgagcgcgagaagcgccgggcgctactctacaagaagcacaacctggctcaggtgcgctgaggcccagccctacagagcaagatgtgcccgccaataaaagatgcaaaacagcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]