GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 10:36:48, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_039087250           25229 bp    mRNA    linear   ROD 21-JAN-2021
DEFINITION  PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and
            titin-interacting RhoGEF (Obscn), transcript variant X30, mRNA.
ACCESSION   XM_039087250
VERSION     XM_039087250.1
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051345.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rattus norvegicus Annotation Release
                                           108
            Annotation Version          :: 108
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..25229
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..25229
                     /gene="Obscn"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 mRNA, 25 ESTs, 33 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 6 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:338458"
                     /db_xref="RGD:631335"
     CDS             186..25175
                     /gene="Obscn"
                     /codon_start=1
                     /product="obscurin isoform X30"
                     /protein_id="XP_038943178.1"
                     /db_xref="GeneID:338458"
                     /db_xref="RGD:631335"
                     /translation="
MDHSFSGAPRFLTRPKAFVVSVGKDATLSCQIVGNPTPHVSWEKDRQPVEAGARFRLAQDGDVYRLTILDLALGDSGQYVCRARNAIGEAFAAVGLRVDSEGTCAEQAPHFLLRPTSIRVREGADATFRCRVGGSPQPAVSWSKDGRRLGAPDAPHVRVEDRGEASALRIRSARPRDGGTYEVRAENPLGSASAAAALVVDSDAEAAGPPGTSVATLLAHLQQRREAMRAEGVPPSPPGAGTRTCTVTEGKHARLSCFVTGEPKPETVWKKDGQLVNEGRRHVVYEDEQENFVLKILFCKQSDRGLYTCTASNLVGQTYSSVLVVVREPAVPFKKRLQDLEVREKESATFQCEVAQPATEAAWFKEETRLWASAKYDIEEEGTERRLTVRNVSADDDAVYICETTEGSRTVAELSVKGNLTRKLPRKTAVRTGDTAIFWVELAVPEGPVQWLRNQEEMVAGGRIAITAEGTCHTLTIFQCTLEDMGEVAFVAGGCRTTTQFCVSAPRRPPLYPPADPVVKAKTESSVTLSWSPPPHGDRPVTIDGYVVEKRKLGAYAWSRCHEAEWLATTEFTIAGVAEEGDFQFRVSAINHFGHSPYLEFPGTMHLVPTLAVKTPLKAVEAMEGGEVTFSVDLTVASSGEWFLDGKALKESSTYVIRCDRTRHMLTIREVPASLHGAQLKFVANGIETSIQMVVRGALGLPSNKLPAVAAREVLAQLHEEAQLLAELSDQAAAVTWLKDGRELSLGPKYEMQVSAGKQALLVRDVAQDDAGLYECVSRGSRITYQLLVQEANLMFAKKQQARSEVKAEVGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRMEASGCSRRLVVQQVGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKGQQSHSKVKAEAGANATLSCEVAQAQTEVTWFKDGKKLSSSSKVCVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFCLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVSWFKDGKKLSSSSKVRMEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGANATLSCEVAEAQTEVSWFKDGKKLSSSSKLRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVMWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKLVFAKEQQACSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVCVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKLVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVPEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKLVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVSWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQACSEVKAEAGASATLSCEVAQAQTEVIWFKDGKKLSSSSKVRVEASGCSRRLVVQQVGKADAGEYSCEAGGQKVSFRLDVPDTKLMFAKEQQACSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPEPESQTPQRPSRREPLVIKEHETIVLSATIAAPSVAAVTWLKDGVEIRRSKRHETTSVGDTHTLTVRGAQVLDSAIYSCRVGKEGQDFPVQVEEVATKFSKPLEPVEGELGGTVTLVCELSPEQAEVVWRCGSTQLRAGKRFQMTAEGSRRTLTVSGLREDDAEEYVCESRDDRTSARLTVKVPRVVKFTSGLSAMAAEEGQEATFQCVVSPSDAAVMWYKDGTQLQPSEKFVMVQSGASRSLTILGLTLEDAGHVTVEAEGASSSAALRVREAPVLFKKKLEPQTVEERTPVTLEVELTRPWPEVKWTRNAAVLVPSENVEIHAEGARHRLVLRSVGFADRGFFGCETPDDKTQAKLNVEMRQVRLVRGLQEVEAKEQGTASMDVELSHADVEGSWTRDGLRLQPGPKCHLAVQGPVHILTLSALQPQDSGLVAFRAEGVHTSARLIVTELPVSFTRLLQDVVATQKEKVTLECELSRPVDVRWLKDGVELRAGKAIGIVAQGTCRSLVIYRCETGDQGVYVCDALDAQTSASLRVQGRSVQIMKPLEDVEVMEKEGATFSCEVSHDEVPGIWFREATKLRPSDNVRIRQEGRTYTLIFRRVLAEDAGEIKFVAENAESRAHLRVKELPVTLLRPLRDKIAMEKHRGVLECQVSRASAQVRWFKGKVELQPGPKYEVVSDGLYRKLVINDVQPEDEDTYTCDAGDVKTSAQFFVEEQSITIVRGLKDMTVMEPAPAWFECETSIPSVRPPKWLLGKTVLQAGGNVGLEQDGTVHRLTLHKTCSTMTGPVHFTIGKSRSTAQLVVSDIPVVLTRPLEPKAGRELQSVVLSCDFRPAPKAVQWYKEDTPLSPSEKFKMVLEGQMAELRILRLTPADAGVYRCQAGSAQSSAEVTVEAREVTVIQPLQDVEAMEEGRVCFSCELSHKDEDIEWSLNGTPLYSDSFHEISHEGCLHTLVLKSVRQADTGTVCATSPKVSVSARLVVKAKPVVFLKALDDVSAEERGTLTLQCEVSDPEARVVWRKDGVELGPSDKYDFLHKAGVRSLTVHDMSHEDAGLYTCQVGSKETQSRVSVHDLHVGITKRLKTVEVLEGESCSFECVLSHESPSDPAVWTVGGKIVRSSDHFQAVRQGRKYTLTVKDAALSDAGEVVFSVLGLTSKASLIIREKPVDITKPLEDQHTTPGEDVMLSCELSRAGSSVRWLKDGKAIRKSQKYDLLIEGTQAVLVVRKASLKDSGEYTCETEASRSTARLCVEEKTNRFTEELADLQVEEKGRAVFTCKTEQPASIVTWRKGLLELRASGKHVPSQEGLTLTLTINALERTDSDTYTCDIGQARTQARLLVHGQKVRVIEDLEDTAVQEGSSAKFCCRISPADYGPVHWFLDKTPLHSNELNEITVQSGGYHVLTLRQLTLKDSGTVYFEAGDQRTSAALRVTEKPSIFSRPLTDVTVTEGEDLTLVCETTTPDSSVRWTKDGKTLRPSARCQLNREGCQAQLVITGTTLQDGGRYKCEVGGASSSSIVRVHARPVRFRESLKDMEVPEGKAATLRCVLSSVAAPVEWRHGDDVLKSSNKYSLRQEGAVLELVIRDLKPQDSGQYSCSFGDQTTSATLTVKTSSAQFIGKLRNKEATEGTMATLRCELTKEAPVEWKKGTETLRNGDKYSLKQDGAVCELQICNLLVADAGEYLCVCGQEKTSATLTVKAVPVHFIRRLRNKEATEGDTVTLQCELSKAAPVEWRKGTETLRDGDRYSLKQDGAVCELQIRSLAVADAGEYLCMCGQEKTSATLTIRALPARFIEDLRSQEVPESSTVTMRCELSKKAPVVWRKGSETLKNGARYSLRQDGAVCELEIRDLTVEDAGEYSCTCGKERTSATLSIMAPQVVFQKLLENLQAEEGSTASLRCELSVPNTAVVWSKGGLELQADTCRETRQQGCVAELLLRDVRREDAGEYSCTCGSQTTSATLMVTAAPVRFLQELQAQDVDEGTTARLRCELSREAASVEWRKGSLQLFPCAKYQMVQEGTTAELLVHGVEQEDAGEYTCDAGHMQSIARLSVRAPKPKFKTGLQSKEQEAGGTARLCCQLSEAESGTPVQWLKEGVELHVSSKYEMRCQGAMCELLIHKLEAKDTGEYACVVGGQKTLASLRVKEPEVTIVQGLVDMEVQADEDVEFTCKVSQAGATDVQWHLQGLPLQSNEVTEVAVLGDGCTHVLQLKGVTLDDAGTVSFHVGSHSSSAQLIVRVPEVTVLEPLKDVQLSEGQDAHFQCRLSRASGQEARWALGGVPLQCNEMNDITVEQGTLYSLTLHKVTLEDAGTITLQVGSCSSEAQLKVTEAALCLVRGLQNVDVFAGEVATFSCEVSRAGGPEARWWLDGTLLQNSPESAMTVREGTVHSLTLSGLGVADSGTITFRTGPLVSTAKLLVKDPTVEVVSAMQDLVVEEGGSAELLCQYSRPVQAMWKMNEREVCADGHRVIIEQDWTVARLTLRPALPCDSGIYSCEAAGTRVVALLQVQAKNTVVRGLENVDALEGGEALFECQLSQPEVAAHTWLLDDEPVHTSANVEVVYFENGLRHLLLLKNLKPQDSCRVTFLAGDVVTSAFLTVRGWRLEVLEPPQDASVKAGTQVCFTCILSEALPVGEATWYINGAAIQPDDADWIVTADGSHHALTLSNAQPQHAGEVTFAARDAVASARLSVLALPGPPEDAEVVGRSDHSVTLSWVAPVSDGGGGLCGYRVEMKEASTGQWQLCHELVPGPECVVDGLVSGKTYRFRVAAVGPAGAGEPVHLPQMVKIAEPMEPKPAPAPAPALAPTPAPIPTPAPAPAPAPTPAPTPTPAPAPAPAPAPATRRAVVGEDVCLELEVAADAGEVVWHKGTERIHPSGHFEVLSQGQRQMLVIKGFRTEDQGEYRCGPIQGLPSSGASTFNVVVTSGSEDEVPAQPSLPPEAAQEGDLHLLWEALARKRRMSREPTLDSISELPEEDSRVQHLRQEAEEAAPDLSEGYSTADELARTGEADLSHTSSDDESRAGTPSLITYLKKAGGPGISPLASKHEAQVATSVKPQKQQERVVPTCPLPGDLNAADLKDPSLDKAAVKIQAAFKGYKVRKEMKQQGGPVFSRTFGDTEAQVGDALRLECVVSTKADVRACWLKDGVELTDGRHYHIDQLKDGTCSLLVTGLGPTDSGRYTCQVSTKFGSVSHSACVMVSGTESEAESSSGGELDDAFRRAARRLHRLFRTKSPAELSEEELFLSADEGPMEPEEPADWQTYREDENFVCIRFESLAEAHRAVTCFRDMFATMGIGVEISLGEQGPRGVEMRIGKVAPTVIPAVPLAKTPGLQTSDAAPVFLTELQNQDVQDGYPMSFDCVVTGQPVPSVRWFKDGKLLEEDDHYMINEDQQGGHQLIITAVVPADMGVYRCLAENSMGVSSTKAELRVELTSTDYDTAADATETSSYFSAQGYLSSREQEGTESDEGQLPQVLEELKDLQVAPGTRLAKFQLKVKGYPAPKLYWFKDGQPLTTSDHIRMTDKKTLHTLEIVSITREDSGQYAAYISNAVGAAYSSARLLVRGPSEPEEKPQPDVHERLVPPRILEKFTPKKVKRGSSITFSVKVEGHPAPSVHWLKEEAEKGVLWIGPDTPGYTMASSSKQHSLVLLDVGRQHQGTYTCIATNAAGQALCSASLHISGLAKEEEQERVKEALISSFLQGTSQAVSAQMSESASFADLVGQRKGESLVAEEAHSHLSLSEVGTEEFLQKLTSQITEMVSAKISQAKLQVPGGDSDEESKTPSASPRHGRSRPSSSVQESSSESEDGDSRGEIFDIYVVTADYLPLGAEQDAIILREGQYVEVLDSAHPLRWLVRTKPTKSSPSRQGWVSPAYLDKRLKLSPEWGPTEAPEFPGEAVSEDEYRTRLSSVIQELLSSEQAFVGELQFLESHHIKHLDRSPRVPAAVASQKTVIFRNVQDISHFHSSFLKELQSCGTDDDVAMCFIKNQEAFEKYLEFLVGRVQAESVVVSTPVQEFYKKYAEEMLSAKDPTQPPPPPLQHYLEQPVERVQKYQALLKELIRNKARNRQNCALLEQAYAVVSALPQRAENKLHVSLMENYPGTLEALGEPIRQGHFIVWEGAPGARMPWKGHNRHVFLFRNHLVICKPRRDSRTDTFSYVFRNMMKLNSIDLNDQVEGDDRAFEVWHEREDSVRKYLLQARTVIIKNSWVKEICGIQQRLAQPVWRPPEFEEELADCTAELGETVKLACRVTGTPKPIVSWYKDGKPVEVDPHHILIEDPDGSCTLILDNLTGIDSGQYMCFAASAAGNASTLGKILVQVPPRFVNKVRATPFVEGEDAQITCTVEGAPYPQIRWYKDGALLTLGNRYRMVNEPRSGMLVLVIQAASKEDLGHYECELVNRLGSTRCGGELYMQSPALRAWDQHHREQLVAAVEDASMEDSAHPTQEGADQQAASVLWRLLGSEALSPSPGGFPNTRQSEPPTSEEAAPQIPGTTSGTPGKLPEASRPGTYKGLEQGMTTTSGSQERNVPIRVEGTAWPGGGTGQLLLDVHSQVIMETTQRTYVCQAPDTGVTRAPSMQVTIEDLQVQVGDMAQFDAVIEGNPPPTVTWYKDSNQLVNGTRLRQQQGGTTYSLVLMDVTPHDAGVYTCVAQNAGGQVLCKAELLVYGGDKSDAEKQAYRRKLHSFYEVQEEIGRGVFGFVKRVQHKGNKMSCAAKFIPLRSKTRAQAYQERDILATLSHPLVTGLLDQFETQKTLILILELCSSEELLDRLFKKAVVTEAEVKVYIQQLVEGLHYLHSHDILHLDIKPPNILMVHPAREDIKICDFGFAQKITPSEPQYSKYGSPEFVSPEIIEQSPVSEGSDIWAMGVISYLSLTCSSPFAGESDRATLLNVLEGRVSWSSPMAAHLSEDAKDFIKATLQKTPRARPSASQCLAHPWFLKSMPAEEAHFINTKQLKFLLARSRWQRSLMSYKSILVMRSIPELLQGPPDSPSLGVARHLRGEASGSSSSSSSSDNELAPFARAKSLPPSPVTHSPLLHPRGFLRPSASLPEETEASMSTADAAMPAPPQSAGPPASPGCVPRHSVISSLFYQQAGEGAERGSKALGAKRHPARRRHLLKGGYIARALPGLREPLMEFSVLEEEAANEEQASLMTKTPSFETALRLPSSNVREVPGRSRSLDNPPGTASPSPEAYKEQYLSPPSSGLTHETTAKGMGHKEGFLQESVPFSPTSGDLRPVKQEGSSQDSCRGKPASSCHSELGSGPQEGCGSPSSQLCGSLPPQSSKKELSKPCGPLFSEQPQAAPFPAQASPLLGSQKEPQDSYLPEKPCPVPSSSPGSASQVDASLDTEGLSEAGDTCDFTPPLQRPQEQATTRKFSLESRGGYAGVAGYGTFAFGGDAGGMLGQGPLWARMAWAVSQSSEEQDEAATESPQPLDSSGPIAEASGVPLRTSPSLTPWEEVEQVSLVQIRDLSGDAEAADTISLDISEVDPAYLNLSDLYDIKYLPFEFMIFRRVPKPVEQPESPGSETEEGQGLAEFLEEAVWPWPGELGLRAGLEITEEPQEPGDLEALLGEAAVGRKRKWSPSRGLFQFPGRCLSGEEPVELGLRQRVKASMAHISRILKGKPEGPEKEGPPRKKAGLASFRLSGLKGRDQAPSFLRELSDEAVVLGQSVTLACQVLAQPTAQATWSKDGALLESSGHLLISSTLKNFQLLTILVVTEEDLGTYTCCVSNPLGTAVTTGVLRKAERPSSSPRPEVGELYTDAVLLVWKPVESYGPVTYIVQCCIEGGSWTTLASDISDCCYLTGKLPRGGMYTFRTACVSKAGMGPYSSPSEQVLLGGPNHLASEEESSRGRPAQLLPSTKTFAFQTQIRRGRFSVVRQCREKASGRALAAKIVPYQPEDKTTVLREYEALKRLHHPHLAQLHAAYLSPRHLVLILELCSGPELLPSLAERDSYSESDVKDYLWQMLSATQYLHAQHILHLDLRSENMMVTEYNLLKVIDLGNAQSLSQEKVPPPENFKDYLETMAPELLEGQGAVPQTDIWAIGVTAFIMLSGEYPVSSEGTRDLQKGLRKGLIQLSRCYAGLSGGAVAFLQSSLCARPWGRPCASTCLQCGWLTEEGPTGSRPTPVTFPTARLRAFVREREKRRALLYKKHNLAQVR"
     misc_feature    210..479
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    210..224
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    order(222..224,231..233,258..260,264..266,270..272,
                     276..278,381..386)
                     /gene="Obscn"
                     /note="Slit binding interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:409353"
     misc_feature    231..248
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    258..284
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    300..317
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    324..332
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    348..359
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    366..386
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    414..440
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    510..785
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    528..545
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    561..584
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    600..617
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    621..629
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    651..662
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    681..701
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    720..743
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    921..1163
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    939..962
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    981..1001
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1002..1013
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1029..1049
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1056..1088
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1098..1124
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1128..1163
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1182..1433
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1188..1208
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    1227..1250
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1263..1280
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1308..1322
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1335..1358
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1377..1400
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1449..1457
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    1452..1661
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    1464..1478
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    1488..1508
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1527..1544
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1551..1562
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    1575..1592
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    1599..1616
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1641..1661
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1668..1694
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1722..1985
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:238020"
     misc_feature    order(1968..1973,1977..1982)
                     /gene="Obscn"
                     /note="Cytokine receptor motif [active]"
                     /db_xref="CDD:238020"
     misc_feature    2028..>2198
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2313..2552
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2322..2336
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    2346..2366
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2385..2402
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2409..2420
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2433..2450
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    2457..2474
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2499..2519
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    2526..2552
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2583..2828
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2583..2591
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    2598..2612
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    2622..2642
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2661..2678
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2685..2696
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2709..2726
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    2733..2750
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2775..2795
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    2802..2828
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2859..3104
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    2859..2867
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    2874..2888
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    2898..2918
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2937..2954
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2961..2972
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    2985..3002
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    3009..3026
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3051..3071
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3078..3104
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    3135..3380
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3135..3143
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    3150..3164
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    3174..3194
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3213..3230
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3237..3248
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    3261..3278
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    3285..3302
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3327..3347
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3354..3380
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    3411..3656
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3411..3419
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    3426..3440
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    3450..3470
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3489..3506
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3513..3524
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    3537..3554
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    3561..3578
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3603..3623
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3630..3656
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    3687..3932
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3687..3695
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    3702..3716
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    3726..3746
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3765..3782
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3789..3800
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    3813..3830
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    3837..3854
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3879..3899
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3906..3932
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    3963..4208
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    3963..3971
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    3978..3992
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    4002..4022
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4041..4058
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4065..4076
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    4089..4106
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    4113..4130
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    4155..4175
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    4182..4208
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    4239..4484
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    4239..4247
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    4254..4268
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    4278..4298
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4317..4334
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4341..4352
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    4365..4382
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    4389..4406
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    4431..4451
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    4458..4484
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    4515..4760
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    4515..4523
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    4530..4544
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    4554..4574
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4593..4610
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4617..4628
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    4641..4658
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    4665..4682
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    4707..4727
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    4734..4760
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    4791..5036
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    4791..4799
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    4806..4820
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    4830..4850
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4869..4886
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4893..4904
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    4917..4934
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    4941..4958
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    4983..5003
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5010..5036
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5067..5312
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    5067..5075
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    5082..5096
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    5106..5126
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5145..5162
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5169..5180
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    5193..5210
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    5217..5234
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5259..5279
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5286..5312
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5343..5588
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    5343..5351
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    5358..5372
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    5382..5402
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5421..5438
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5445..5456
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    5469..5486
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    5493..5510
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5535..5555
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5562..5588
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5619..5864
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    5619..5627
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    5634..5648
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    5658..5678
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5697..5714
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5721..5732
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    5745..5762
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    5769..5786
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5811..5831
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5838..5864
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5895..6140
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    5895..5903
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    5910..5924
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    5934..5954
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5973..5990
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5997..6008
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    6021..6038
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6045..6062
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6087..6107
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6114..6140
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6171..6416
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    6171..6179
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    6186..6200
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    6210..6230
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6249..6266
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6273..6284
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    6297..6314
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6321..6338
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6363..6383
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6390..6416
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6447..6692
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    6447..6455
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    6462..6476
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    6486..6506
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6525..6542
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6549..6560
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    6573..6590
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    6597..6614
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6639..6659
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6666..6692
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6744..6944
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    6771..6785
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6810..6824
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6885..6899
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6927..6944
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    7002..7244
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    7002..7010
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    7017..7028
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    7038..7058
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    7077..7094
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    7101..7112
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    7125..7142
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    7149..7166
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    7191..7211
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    7218..7244
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    7263..7514
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    7284..7298
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    7308..7328
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    7347..7364
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    7371..7382
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    7395..7412
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    7419..7436
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    7461..7481
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    7488..7514
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    7533..7784
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    7539..7559
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    7578..7601
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    7614..7631
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    7635..7646
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    7659..7673
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    7686..7709
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    7728..7754
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    8064..8312
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    8088..8099
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    8109..8129
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    8145..8162
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    8169..8180
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    8193..8210
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    8217..8234
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    8259..8279
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    8286..8312
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    8328..8579
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    8376..8390
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    8415..8426
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    8487..8501
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    8529..8546
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    8601..8846
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    8646..8657
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    8679..8693
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    8754..8768
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    8796..8813
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9132..9383
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    9180..9194
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    9219..9230
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    9291..9305
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    9333..9350
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9402..9650
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    9414..9431
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    9447..9467
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    9483..9503
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    9504..9515
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    9531..9548
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    9555..9587
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    9621..9650
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    9666..9917
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    9714..9728
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    9750..9764
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    9825..9839
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    9867..9884
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9936..>10142
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    9948..9965
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    9978..10001
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    10023..10043
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    10044..10055
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    10068..10088
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    10095..10127
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    10239..10457
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    10251..10271
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    10290..10307
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    10314..10325
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    10338..10355
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    10362..10379
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    10404..10424
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    10431..10457
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    10473..10724
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    10521..10535
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    10557..10571
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    10632..10646
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    10746..10997
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    10755..10772
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    10785..10808
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    10827..10847
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    10848..10859
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    10875..10895
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    10902..10934
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    10962..10997
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    11016..11264
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    11034..11048
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    11058..11078
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    11097..11114
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    11121..11132
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    11145..11162
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    11169..11186
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    11211..11231
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    11238..11264
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    11280..11531
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    11286..11297
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    11301..11312
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    11322..11351
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    11364..11381
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    11388..11396
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    11412..11429
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    11436..11459
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    11499..11531
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    11547..11795
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    11592..11612
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    11628..11645
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    11652..11663
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    11676..11693
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    11700..11717
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    11742..11762
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    11769..11795
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    11811..12059
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    11856..11876
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    11892..11909
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    11916..11927
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    11940..11957
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    11964..11981
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    12006..12026
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    12033..12059
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    12075..12323
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    12084..12104
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    12123..12146
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    12159..12173
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    12177..12188
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    12201..12215
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    12228..12251
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    12339..12590
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    12345..12353
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    12360..12374
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    12384..12404
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    12423..12440
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    12447..12458
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    12471..12488
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    12495..12512
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    12537..12557
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    12564..12590
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    12606..12857
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    12651..12671
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    12690..12707
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    12714..12725
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    12738..12755
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    12762..12779
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    12804..12824
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    12831..12857
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    12906..13130
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    12918..12938
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    12963..12980
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    12987..12998
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    13011..13028
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    13035..13052
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    13077..13097
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    13104..13130
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    13149..13406
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    13194..13208
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    13233..13247
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    13308..13328
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    13413..13679
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    13437..13454
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    13467..13490
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    13509..13529
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    13530..13541
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    13557..13577
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    13584..13616
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    13644..13679
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    13701..13916
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    13710..13727
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    13740..13763
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    13782..13802
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    13803..13814
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    13830..13850
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    13857..13889
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    13968..14186
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig_3; pfam13927"
                     /db_xref="CDD:404760"
     misc_feature    14235..14492
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    14508..14768
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    14523..14540
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    14553..14576
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    14598..14618
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    14619..14630
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    14646..14666
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    14673..14705
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    14715..14741
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    14778..15035
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:238020"
     misc_feature    order(14778..14780,14973..14975,15018..15020)
                     /gene="Obscn"
                     /note="Interdomain contacts [active]"
                     /db_xref="CDD:238020"
     misc_feature    order(15021..15026,15030..15035)
                     /gene="Obscn"
                     /note="Cytokine receptor motif [active]"
                     /db_xref="CDD:238020"
     misc_feature    15225..15410
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:416386"
     misc_feature    15243..15263
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    15282..15299
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    15306..15317
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    15330..15347
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    15354..15371
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    16020..16292
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    16029..16040
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    16044..16055
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    16065..16094
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    16107..16127
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    16134..16142
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    16158..16175
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    16182..16208
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    16230..16253
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    16260..16292
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    16710..16982
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    16710..16721
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    16728..16745
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    16758..16781
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    16800..16820
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    16821..16832
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    16848..16868
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    16875..16907
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    16917..16943
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    16947..16982
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    17106..17378
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    17121..17135
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    17157..17186
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    17199..17216
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    17223..17231
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    17247..17264
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    17271..17288
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    17313..17339
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    17346..17378
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    17439..17726
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    17439..17447
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    17451..17471
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    17490..17513
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    17529..17546
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    17550..17561
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    17583..17606
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    17619..17642
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    17661..17687
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    18132..18320
                     /gene="Obscn"
                     /note="Src homology 3 domain of Obscurin and similar
                     proteins; Region: SH3_Obscurin_like; cd12025"
                     /db_xref="CDD:212958"
     misc_feature    order(18153..18155,18159..18161,18168..18170,18186..18188,
                     18240..18245,18300..18302,18306..18311)
                     /gene="Obscn"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212958"
     misc_feature    18417..18947
                     /gene="Obscn"
                     /note="Guanine nucleotide exchange factor for
                     Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous
                     (DH) domain. It appears that PH domains invariably occur
                     C-terminal to RhoGEF/DH domains; Region: RhoGEF; cl02571"
                     /db_xref="CDD:413383"
     misc_feature    order(18426..18428,18438..18440,18804..18809,18816..18821,
                     18825..18830,18837..18842,18849..18854,18861..18863,
                     18939..18941)
                     /gene="Obscn"
                     /note="GTPase interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238091"
     misc_feature    18972..19346
                     /gene="Obscn"
                     /note="Obscurin pleckstrin homology (PH) domain; Region:
                     PH_Obscurin; cd13239"
                     /db_xref="CDD:270059"
     misc_feature    19368..19640
                     /gene="Obscn"
                     /note="First immunoglobulin-like domains A168 within the
                     A-band segment of human cardiac titin, and similar
                     domains; a member of the I-set of IgSF domains; Region:
                     IgI_1_Titin-A168_like; cd20971"
                     /db_xref="CDD:409563"
     misc_feature    19419..19433
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409563"
     misc_feature    19458..19472
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409563"
     misc_feature    19539..19553
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409563"
     misc_feature    19578..19595
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409563"
     misc_feature    19617..19628
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409563"
     misc_feature    19647..19886
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig_3; pfam13927"
                     /db_xref="CDD:404760"
     misc_feature    19647..19658
                     /gene="Obscn"
                     /note="Ig strand A [structural motif]; Region: Ig strand
                     A"
                     /db_xref="CDD:409353"
     misc_feature    19665..19679
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409353"
     misc_feature    19701..19727
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    19740..19757
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    19764..19772
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    19788..19805
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409353"
     misc_feature    19818..19835
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    19860..19886
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    19893..19925
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    20412..20681
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    20460..20483
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    20502..20522
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    20523..20534
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409353"
     misc_feature    20571..20606
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    20616..20642
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    20646..20681
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    20733..21503
                     /gene="Obscn"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:419665"
     misc_feature    order(20760..20774,20778..20780,20784..20786,20823..20825,
                     20829..20831,20913..20915,20961..20966,20970..20972,
                     20982..20984,20988..20990,21099..21101,21105..21107,
                     21111..21116,21120..21122,21156..21161,21168..21170,
                     21213..21224)
                     /gene="Obscn"
                     /note="active site"
                     /db_xref="CDD:270870"
     misc_feature    order(20760..20774,20778..20780,20784..20786,20823..20825,
                     20829..20831,20913..20915,20961..20966,20970..20972,
                     20982..20984,21111..21116,21120..21122,21156..21161)
                     /gene="Obscn"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(20772..20774,20982..20984,20988..20990,21099..21101,
                     21105..21107,21111..21113,21168..21170,21213..21224)
                     /gene="Obscn"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    21156..21224
                     /gene="Obscn"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270870"
     misc_feature    23652..23900
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    23703..23717
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    23742..23756
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    23817..23834
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    23862..23879
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    23904..23915
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    23934..24170
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; Region: FN3; smart00060"
                     /db_xref="CDD:214495"
     misc_feature    24270..25040
                     /gene="Obscn"
                     /note="Protein Kinases, catalytic domain; Region:
                     PKc_like; cl21453"
                     /db_xref="CDD:419665"
     misc_feature    order(24300..24314,24318..24320,24324..24326,24363..24365,
                     24369..24371,24453..24455,24501..24506,24510..24512,
                     24522..24524,24528..24530,24639..24641,24645..24647,
                     24651..24656,24660..24662,24690..24695,24702..24704,
                     24753..24764)
                     /gene="Obscn"
                     /note="active site"
                     /db_xref="CDD:270870"
     misc_feature    order(24300..24314,24318..24320,24324..24326,24363..24365,
                     24369..24371,24453..24455,24501..24506,24510..24512,
                     24522..24524,24651..24656,24660..24662,24690..24695)
                     /gene="Obscn"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    order(24312..24314,24522..24524,24528..24530,24639..24641,
                     24645..24647,24651..24653,24702..24704,24753..24764)
                     /gene="Obscn"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:270870"
     misc_feature    24690..24764
                     /gene="Obscn"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:270870"
ORIGIN      
gcctgtcctttcgtccctgtccagtctgaggaccggctggagtgtgggctgctgggtgggaaccacgtcgtcctgggccccaggaaggaggcagacccagcagccccccaactcaccatctgtgccccttgcctgggtgctgccccaacccctggtagacacagtcccccaaccctgctaacatcatggaccactccttcagcggagcaccccgcttcctgacgcggccaaaggcttttgtggtatctgttggcaaggatgccacgctgagctgccagatcgtgggcaaccccacgccacacgtgagctgggagaaggaccggcagccagtggaggcaggagcacgcttccgcctggcccaggacggggatgtgtaccgcctcaccatcctcgatctggctctaggtgacagcgggcagtacgtgtgtcgagcgaggaacgccataggggaggccttcgccgctgtaggtttgcgagtggactcggagggcacgtgtgccgagcaggcgccccactttctgctgcggcccacctccattcgtgtgcgcgagggcgcagacgccaccttccgatgtcgcgtcggcggctcaccgcaacctgctgtgagctggtccaaagatgggcggcgcctaggtgcaccagatgccccccacgtgcgcgtggaagatcgcggagaggcgagcgcgcttcgcatccggtcggcaaggcctcgcgatggtggcacctacgaagttcgagcagagaacccactgggctccgccagcgctgccgccgctctcgtggtggactcggatgccgaggctgccggaccacccggaacctccgttgccacgctcctggcgcacctgcagcagcggcgcgaggccatgcgcgcagagggcgtccctccttctccacctggtgctggcacgcgcacctgcacggtgaccgaaggcaaacacgcgcgcctcagctgctttgtgaccggcgagcccaagcccgagacagtgtggaagaaggacgggcagctggtgaacgagggccggagacacgtagtatatgaggatgagcaagagaacttcgtccttaagattcttttttgcaagcagtctgatcgcggcctctacacttgcacagcatccaacctcgtgggccagacctacagctcggtgctggtggtcgtgagagagcctgcggtgcccttcaagaagcggctgcaggacctggaggtgcgagagaaagagtctgccacattccagtgtgaggtggctcagccagccaccgaggcggcgtggttcaaggaggagacccggctatgggccagcgccaagtacgacatcgaggaggagggcaccgagcgccggctgactgtgcgcaacgtctcggcagacgacgacgcggtgtacatctgcgagaccacagagggcagccgcacggtggcagagctctcagttaaaggaaacttgaccagaaagctgcctcggaaaacagcagtgaggactggagacacagccatcttttgggtggagctggctgtccccgaaggccctgtccagtggctacggaaccaggaggagatggtggcagggggcaggattgccatcactgcagaaggcacttgccacacactgaccatcttccagtgcaccttggaggacatgggtgaggtggccttcgtggctggtggctgcagaacgactacccagttctgtgtatcagcacccaggaggccacccctgtaccctcctgctgaccctgttgtgaaggccaagacagagagttctgtgacccttagctggtccccaccaccccatggggaccgccctgtcactattgatggttatgtggtggagaagaggaagctgggtgcctatgcctggagcaggtgtcatgaagcagaatggctggccacaactgagtttactattgctggcgtggctgaggaaggggacttccagttccgagtgtcagccatcaatcactttggccacagtccttaccttgagtttccagggaccatgcacttggtccccacgctggctgtaaagacacctctgaaggcggtggaggccatggagggtggtgaggtcactttctccgtggacctcacggtggcgtcttcgggtgagtggttcctggacgggaaggccttgaaagagagcagtacatacgtgatccgttgtgaccgtacccggcacatgctcaccatcagagaggtgcctgccagcttgcacggggcacagctgaagtttgtggctaatggcattgaaaccagcatccaaatggtggtccgaggggctctggggctgcccagcaacaagcttcctgccgtggctgcccgggaggtgctggcccagctgcatgaggaggcacagctgctggctgagctgtcagaccaggctgcggctgtgacttggctaaaggatggtcgtgagctgtccctaggacccaagtatgagatgcaggtgtcggctgggaagcaagcactgctggtgcgggatgtggcacaggatgacgctgggctctatgagtgtgttagtcgtgggagccgcatcacctaccagctgttggtgcaagaggccaatttgatgtttgccaagaagcagcaggcacgcagcgaggtgaaggcagaggttggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcatggaggcctcgggctgctccaggaggctggtggtgcagcaggtgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggggcagcagtcacacagcaaggtgaaggcagaggcaggggccaatgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctccaaggtgtgtgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttctgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcaggagccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgtcatggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcatggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtcacagaacccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccaatgccacactgagctgcgaggtggccgaggcccagactgaggtgtcatggttcaaggacgggaagaagctgagctccagctccaagctgcgtgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagaacccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggatgtggcagaacccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcgggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggctcgcagcgaggtgaaggcagaggcgggggccagtgccacactgagctgcgaggtggcccaggcccagactgaagtgatgtggttcaaggacgggaagaagctgagctccagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaagctggtgtttgccaaggagcagcaggcatgcagtgaggtgaaggcagaggccggggccagcgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctctagctcgaaggtgtgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggacgtagcagagcccaagctggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaagcgggcaaggcagatgctggagagtacagctgtgaggccgggggacagaaggtctccttccgcctggatgtgccagagcccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctccaaggtgcgagtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggacgtcacagagcccaagctggtatttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggctggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcaggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgtcgtggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggcatgcagcgaggtgaaggcagaggcaggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgatatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggtgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggatgtgccagacaccaaacttatgtttgccaaggagcagcaggcatgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgtgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtggcagaaccagagcctgagtcccaaactccacagaggcctagccgcagggagcctctggttatcaaggaacatgagaccattgtcctgagtgccacgatagctgcaccctctgtggctgctgtgacctggctcaaagacggcgtggagatccgccgcagcaagcggcatgagaccaccagtgtgggtgatactcataccctgactgtgagaggtgcacaggttctggacagtgccatctacagctgccgtgtcggcaaggaaggtcaggacttcccggtgcaggtagaagaggtggccaccaagttctccaaacccctggagcctgtggaaggggaattgggtggcactgtgacgctggtctgtgagctgagcccggaacaggctgaggttgtgtggcgctgtgggagcacacagctgcgggcgggcaagcgcttccagatgacagctgaggggtctaggcgcacactgaccgtgtctggccttcgagaggacgacgcagaggagtatgtgtgtgagagccgggatgaccgcaccagtgcacggctcactgtcaaagttccccgagtggtcaagtttacatccggattgagtgccatggcggcagaggagggccaagaggccacctttcagtgtgtcgtgtcccccagcgatgcagcagtcatgtggtacaaggacggcacgcagctgcagcctagcgagaagtttgttatggtgcagagtggggccagccgaagcttgactatcttgggcctgaccctggaggatgctgggcatgtcactgtggaggctgagggtgcttcatcatctgctgccctccgggtccgagaggcaccagtcctcttcaaaaagaagcttgagccacagacggtggaggagaggacccctgtgaccctggaagtagagctgactcgcccctggcccgaggtgaagtggacgcggaatgctgccgtcctggtacccagcgagaacgtggaaatccacgctgagggtgcccggcaccgtctggtgctgcgaagcgtgggcttcgctgaccgtggcttctttggctgtgagacaccagatgacaagactcaggccaagctcaacgtagaaatgcggcaggtccggctggttcgaggtttgcaggaggtggaggctaaggaacagggcacagcctcgatggatgtggaattgtcccatgctgacgtggaaggcagctggactcgagatggcctgcgacttcagccggggcccaaatgccacctggccgtacaaggccctgtccacatcctcacactctcagcgctgcagccacaggacagcgggttggtggccttcagggctgagggcgtgcacacgtctgcacggctcatagtcactgagttgcccgtgagcttcaccagactgctacaggatgtggtggccactcagaaggagaaggtgaccctggagtgtgagttgtcacggcccgtcgatgtgcgctggctgaaggatggtgtggagctgcgggcaggcaaggccataggcatagtggctcagggaacctgcaggagtctcgttatctaccggtgtgagactggggaccagggcgtctatgtatgtgatgctctggatgctcagacctctgcctctctgagggtgcagggacgcagtgttcagattatgaagcccctagaggatgtggaggtgatggagaaggagggtgccacattctcctgtgaggtgtcccatgatgaggttcctggcatatggttccgagaagccactaagctacggcccagtgacaatgtgcgcatccggcaggaagggaggacatatactctcatcttccggagggtactggcagaagatgcgggggagatcaagtttgtagctgaaaatgcagaatcaagggctcacctccgagtgaaagaactgcctgtgaccctcctgcgcccactacgggacaagattgccatggaaaaacaccgtggcgtgcttgagtgccaggtgtcccgggctagtgcccaggtgcggtggttcaagggcaaagtcgagctgcagcctgggcccaagtatgaggtggtcagcgacggcctttaccgcaaactggtcatcaatgatgtgcagcccgaggacgaagatacttacacctgtgatgctggcgatgtgaagaccagtgcccagttcttcgtggaagagcaatccatcactattgtgcgggggctgaaggacatgacagttatggagcctgcccctgcctggtttgaatgtgagacctccattccttctgtgaggccacccaagtggctccttggtaagactgtgctacaggcaggggggaacgtggggctggagcaagacggtactgtgcaccgactgacacttcacaagacctgctctaccatgaccgggcctgtgcacttcaccatcggcaagtcccgctccactgcccagcttgttgtctcagacattcctgtggtattgacaaggcctctggagcccaaagcagggcgcgagctgcagtcggtcgtcctgtcctgtgacttcaggccagcccccaaggctgtgcagtggtacaaggaggatacacctctgtccccgtcagaaaagttcaagatggtgctggagggccagatggcagagctgcgtatactccggcttactccagctgatgctggggtctaccggtgccaggcgggtagtgcccagagcagtgccgaggttactgtggaagctcgggaggtgacagtgatccagccactgcaggatgtggaagccatggaggaaggccgggtctgcttctcctgtgagctatctcataaggacgaggatatcgaatggtcactcaatggtacacccctgtactcggacagcttccacgagatcagccatgagggctgtctccacacgctggtgctgaagagtgtccggcaggctgacacgggcaccgtgtgtgccacctctcccaaggtgtcagtttctgcccggctggtggttaaagcaaagccagtggtgttcctaaaagcactggatgacgtatctgcagaagagcggggcacgctgaccctgcagtgcgaggtctccgacccggaggcgcgtgtggtttggcgcaaagatggtgtggagttgggtcccagcgacaagtatgacttcctacacaaggcaggtgttcggagccttacggtccatgacatgagccacgaggatgctggactgtacacctgccaggtgggcagtaaggagacccagtccagggtcagcgtgcatgaccttcatgtgggcatcaccaagaggttaaagacggtggaggtgctggagggagagagctgcagctttgagtgtgtcctctcccatgagagtcccagtgacccagcagtgtggacagttggtgggaagatagtgcgtagttctgaccacttccaggccgtacggcagggccgcaaatacactctgacagtcaaagatgctgccctcagtgatgcaggagaggtggtcttctcagtgctgggcctcacatccaaggcctcgctcatcatcagagagaagccagtggacatcacaaagcccctggaggaccagcacactacgcctggggaagatgtgatgctaagctgcgagctctctagggcaggctcctccgtgcgctggctgaaagacgggaaggccatccggaagagtcagaagtatgacctgctcattgaaggcacacaggctgtgttggttgtccgaaaggcctcgctcaaggattctggagaatacacctgtgagacagaagcctccagaagcactgccaggctgtgtgtggaagaaaagacaaaccggttcacggaggagctggctgacctgcaggtagaagagaagggcagagctgtgttcacatgcaagacagagcaaccggcatctattgtgacctggcgcaaaggcctcctggagctgcgcgcctcagggaagcatgtccccagccaggagggtttgaccctgacgcttactatcaatgccctggagaggacagacagtgacacttacacctgtgacattggccaagcccggacccaggcccggctcctcgtccatggccagaaagtacgagtcattgaggacctagaggacaccgctgtccaggagggctcctctgccaagttttgctgccgcatctcccctgctgactacggccctgtgcactggttcctggataagacccctttgcacagcaacgagctgaacgagatcactgtccagtccggaggctaccacgtgctcaccctgcggcagctgacgctcaaggattcaggcacggtctacttcgaggcgggtgaccagcggacctcagctgccctgcgggtgactgagaagccgagcatcttctctcggccactcacagatgtcacagtcacagaaggcgaggacctgactctcgtctgtgaaaccaccaccccggatagctctgtgcgctggaccaaagatgggaagacactgaggccatctgcacgatgccagctgaaccgcgaaggctgtcaggcccagctggtcatcactggcactaccctacaggatggcgggcggtacaaatgtgaggtgggcggagcctccagcagctccattgtcagggttcacgctcggccagtgcggttcagggagtccctgaaggacatggaggtgccagagggcaaggctgccacactacgctgtgtgctgtcatccgtggctgcacctgtggagtggcgtcacggagatgatgtcctgaaatccagcaacaagtatagcctgcgccaagagggtgctgtgctggaactggtcatccgagacctgaagccccaggacagcgggcagtactcatgctcctttggggaccagacaacttcagccacactcacagtgaaaacctcgtctgcccagttcataggaaaactgagaaacaaggaggccacagaagggaccatggccacacttcggtgtgagctgaccaaagaggcccccgtggaatggaagaagggaacagagaccctgagaaatggggacaaatacagtctgaagcaggatggagctgtgtgtgaactgcagatctgtaacctgcttgtggcagacgcgggggagtacttgtgtgtatgcgggcaggagaagacttcagccacgctgactgtcaaggccgttcctgtccactttatcagaaggctcaggaacaaggaggccacagaaggggacacggtcacactgcagtgtgaactgagcaaggcggcccccgtggagtggaggaagggaacagagaccctgagagatggggacagatacagcctgaagcaggatggggccgtgtgtgagctgcagatccgcagcctggctgtagcagatgctggagagtacttgtgcatgtgtggacaggaaaagacctcagccacactgaccatcagggcccttccagccagattcatagaagatttgagaagccaagaggtcccggaaagttcaacagtcacaatgcggtgtgagctaagcaagaaggcccctgtggtgtggaggaaagggtctgagaccctgaaaaatggggccaggtacagcctgagacaggatggtgctgtgtgtgagctggagatccgtgacctgactgtggaagatgctggagagtactcatgcacatgtgggaaggagaggacctcagccacactgagcattatggctccacaggtggtgttccagaagttactggagaatctgcaagcagaagaaggctccacagccagcctgcggtgtgagctgtcagtccccaacactgctgtggtctggagcaagggcggcctggagctgcaggctgacacatgccgagagacacggcagcagggctgcgttgcagaactgctgcttagggacgtgcgccgtgaggacgcgggcgagtacagctgtacctgtggttcccagaccacaagtgccacactcatggtcacagctgctcctgtgaggttcctccaggagctacaggcccaggacgtagatgaagggaccaccgcacgcctgcgctgtgagctgagccgggaggctgcgagtgtggaatggcgcaagggctccttgcagctttttccttgtgctaagtatcagatggtgcaggagggcacaactgcagagctgctagtccatggggtggagcaggaggatgcaggggaatacacctgcgatgcaggacacatgcagagcattgccaggctctccgtccgagcccccaagcccaagttcaagaccggcctacagagcaaagagcaagaagcaggtggcacagcacggctgtgttgtcaactgagcgaagctgagtcggggactccagtacaatggctcaaagagggggtggagctgcatgtcagctccaagtacgagatgcggtgccaaggggctatgtgtgagttgctgatccacaagctggaggccaaggacactggtgaatatgcctgcgtggtgggtggccagaagaccttggcctccctcagagtcaaagagcctgaggtgaccattgtgcagggactggtggacatggaggtgcaggctgatgaggatgtggagttcacttgcaaggtgtcacaggcaggagccacagatgtgcagtggcatctccaaggtctgccactgcagagcaatgaagtgacagaggtggctgttcttggagacggctgtacccatgtgctccagttgaagggtgtgacactggatgatgctggtactgtctccttccacgtgggcagccattcatcttctgctcagctcatagtccgagtccccgaggtgaccgttctggagcccctgaaggatgtgcagctcagcgagggccaggatgcccatttccagtgccggctgtccagggcttcgggccaggaggctcgctgggctttgggaggagttcccttgcagtgcaatgagatgaatgacatcactgtggagcagggcacactctactcgctcactctgcacaaggtgaccctcgaggatgccggaaccatcactctccaagtgggctcatgctcctcagaggcccagctgaaggtcacagaggcagcactgtgcctggtacgaggcttgcagaatgtggatgtcttcgcgggggaggtggccacgttctcctgtgaggtatctcgagcaggtgggccagaggcccgctggtggctggatggcaccctgcttcagaacagccctgagagtgccatgactgtacgagagggtactgttcactccctcacgctctcgggcctgggggtggctgactcaggcaccatcaccttccgcacggggcccctggtctccacagccaagttattggtcaaagatcccacagtggaggtggtgagtgccatgcaggacctggtggtggaggagggtggctcggccgagctcctctgccagtactcgcggcccgtgcaggccatgtggaagatgaacgagcgggaggtgtgcgcggatgggcaccgtgtcatcatagagcaggactggaccgtagccaggctgaccctcaggccggccctgccctgtgacagtggcatctattcttgtgaggctgcgggcactcgagttgtggcactgctccaagtgcaagccaagaacacagtggtgcgtggcctggagaatgtggatgcactggagggcggcgaagctctgttcgagtgtcagctgtcccagccggaagtggctgcccacacctggttactagacgatgagcctgtgcacacatcagcaaacgtggaggtggtctactttgagaacggactgcgccacttgcttttgctcaaaaacctgaagccacaggacagctgccgagtgaccttcctggcaggggacgtggtcacgtctgccttcctcactgtgagaggctggcgcttggaggtcctggagcccccacaagacgcatctgtgaaagctggtacgcaggtctgcttcacttgcatactaagtgaggccctgcctgtgggcgaggctacttggtacatcaacggggctgccatccaacctgatgacgctgactggatagtcaccgcagatggcagccaccatgccctgacgctgagcaacgcccagccccagcacgcaggagaggtcacatttgcagcacgtgacgccgtggcctctgcacgcctctctgtgttggctctccctggtccccctgaagatgctgaagtagtgggtcgaagtgaccactctgtgaccctatcctgggtggctcccgtgagtgacggcggcggcggtctatgtggttatcgtgtggagatgaaggaggcatccacaggccagtggcagttgtgccatgagttggtacctggcccagagtgtgtggtggacggcctggtctctgggaagacctaccgcttccgagtggcagccgtgggtccggcaggagctggggagcctgtacatctgccccagatggtcaagatagcagagccaatggaacctaaaccagccccagccccagcccctgccctagccccaaccccagctccaatcccaaccccagccccagccccagccccagccccaaccccagccccaaccccaaccccagccccagccccagcccctgccccagccccagcaacacggcgagcagtggttggtgaagatgtgtgtctggagctggaagtggcagctgatgctggcgaggtcgtctggcacaagggaacagagcgcatccatcccagtgggcactttgaggtcctctctcagggtcagcggcagatgctggtgatcaagggctttaggaccgaagaccagggggagtaccgctgtggtcccatccagggcctgccctcctcaggagcttctactttcaatgtggtcgtgacctcgggctcggaggatgaggtccctgcacagcccagcctgcctcccgaggcagcccaggagggtgacctgcatctgctttgggaggcccttgctcggaagcgtcgcatgagccgggagcccacgctggactccatcagtgagctgcccgaggaagacagccgtgtgcagcatctgcggcaggaggcagaagaggcggctcctgacctctctgagggctactccacagccgatgagctcgcacgcacaggagaagctgacctctcacacaccagctctgatgacgagtctcgggctggcaccccttccctaattacctacctcaagaaggccgggggtcctgggatctcacccttggccagcaagcatgaggcccaggtggccacgtctgtgaagccacaaaagcagcaggagcgggttgtgcccacatgcccactgccgggagatttgaacgcagcagatttgaaggatccatccctggacaaggccgctgtgaagatccaggctgcctttaagggctacaaagtgaggaaggagatgaagcagcagggaggccccgtgttctcacggacatttggggacacagaggcacaggttggggatgcgctgcggctggagtgtgtggtgtccaccaaggctgacgtgcgggcctgctggttgaaggatggcgtagagttaacagatgggcgccattaccacatagaccagctcaaggacggtacctgctctctgctggtcactggcctgggccccactgactctggtcgctacacctgtcaggtgagcaccaagtttggaagcgtgagccacagtgcctgcgtaatggtcagtgggacagaaagtgaggctgagagctcctcaggaggtgagctggacgatgccttccgccgggcagcacgacgcctgcatcgtctcttccgaaccaagagcccagctgagctttcagaagaggagctcttcctcagtgctgacgaaggccccatggagccagaggagcctgcagactggcaaacataccgagaggatgaaaactttgtgtgcatccgttttgagtcacttgcagaggcccaccgggcagtcacctgcttccgtgacatgtttgccaccatgggcatcggggtggagatcagcctaggggagcaggggccccggggagtggagatgcgcattggcaaggtggcccccactgtcatccctgcggtgccacttgcaaagacacctggcctgcagacttcagatgctgccccagtgttcctgacggagctgcagaaccaagacgtgcaggacggataccccatgagcttcgactgcgtggtaacaggccagcctgtgcccagtgtgcgctggttcaaggacgggaagttgctagaagaggatgaccactacatgatcaacgaggaccaacaggggggtcaccagctcatcatcacagccgtggtgccggcagacatgggagtgtaccgctgcctggcggagaacagcatgggcgtctcctccaccaaggctgagcttcgtgtggaattgaccagcacagactatgacactgctgctgatgctaccgagacctcatcctacttcagcgcccagggatacctgtccagccgggagcaagaggggacggagtcagatgaggggcagcttccccaggtgctggaggaactgaaagacctccaggtggcccctggcacacgcctggccaagttccagctcaaggtgaaaggttatccagctcccaaactgtactggttcaaagatggccagcccctgaccacatctgaccacatccgcatgactgacaaaaagaccctgcacaccctggagattgtctccatcacccgagaggacagcggccagtacgcggcctacatcagcaatgctgtgggtgccgcctattcgtcagcccggctgctggtccgaggtcccagtgaaccagaagagaagccacaaccagatgttcatgagaggctggtgccaccccgaatcctggagaagttcacccccaagaaagtgaagaggggctccagcatcaccttttcagtgaaggtggaaggacacccggcccccagtgtgcattggctcaaggaggaggcagagaagggagtcctgtggattggccctgatacccctggctacacgatggccagttcttccaagcaacatagcctggtcctgctggacgtaggccgacagcaccagggcacctacacgtgcattgccaccaatgctgctggccaggcgctctgctctgccagtctgcacatctctggcttggccaaagaagaggagcaggagagagtgaaggaggctctcatttcctccttcctgcaagggacgagccaagctgtctcagcccagatgtcagaatctgcaagttttgctgatcttgtcgggcaaaggaaaggtgagtccctggtggctgaggaggcccacagtcacctgtccctttctgaggtgggcacagaagagttcctgcagaaactcacctcacagatcaccgagatggtatcagccaagatctcgcaggccaaactccaggtgcctggaggtgacagtgatgaggagtctaagacaccatctgcttctcctcggcacggccggtcacgtccttcctccagtgttcaagagtcttcctcagagtcagaggatggagactcccgtggtgagatctttgacatctacgtggtcacagctgattatctgcccctgggagctgagcaggatgccatcatcctgagagaaggccagtatgtggaggtcctggactcagcccatcccctgcgctggcttgtacgcaccaagcccaccaaatccagcccttccaggcagggctgggtgtcacctgcctacctggacaagaggctcaagctatctcctgagtgggggcccactgaggcccctgagttccctggcgaggctgtgtctgaggatgagtatagaacgaggctgagctctgtcatccaggagttgctgagttcagagcaggcttttgtgggtgagttacagttcttggagagccaccacatcaagcacctggaccgatctccccgtgtacccgcagctgtggccagccagaagacggtcatctttcgtaatgtgcaggacatcagccatttccacagcagcttcttgaaggagctgcagagctgtggcaccgacgatgatgtagccatgtgcttcatcaagaaccaggaggcctttgagaagtaccttgagttcctggtgggccgggtgcaagcggaatcagtggtcgtcagcaccccagtccaggagttctacaagaaatatgcagaagagatgctgtcagccaaggaccccacacagccacccccacctcctcttcagcactacttggagcagccagtggaacgggtgcagaaataccaggccttgctgaaggagctaatccgcaacaaggctcgcaaccggcagaactgtgcgctgctggagcaggcctacgctgtggtgtctgccctgcctcagcgtgctgagaacaagctgcacgtttctctcatggagaactacccgggaaccctggaggccctgggagaacctatccgccagggtcacttcatagtgtgggagggggctccaggagcccggatgccttggaagggccacaaccggcatgtcttcctcttccgaaaccacctggtgatctgcaagccccggagagactctcgaacggacaccttcagctacgtgttccggaacatgatgaagctgaatagcatcgacctgaatgaccaggtagagggggatgaccgtgcctttgaggtgtggcacgagcgggaagactctgtccgcaagtacctgctgcaggcgcggacagtgatcatcaaaaactcatgggtgaaggagatctgtggcatccagcagcgccttgcccagcccgtgtggcgtccccctgagtttgaagaagaactagctgactgcacagccgagctgggtgaaacagtcaagctagcatgccgagtgactggcacacctaagcctattgtcagctggtacaaagatgggaagcccgtggaggtggacccacaccacatcctcattgaagaccctgatggctcctgtaccctcatcttggacaaccttactggcatagactctggccagtacatgtgttttgcggccagtgctgctggcaatgccagcaccttggggaagattctagtacaagtgcccccacgatttgtgaacaaggtccgagccacaccctttgtggagggagaggacgcgcagatcacctgcacagtggaaggagctccgtaccctcagatcaggtggtacaaggacggtgccctgctaaccctgggcaacaggtaccggatggtgaatgagccccgcagtggtatgctggtgctggtgatccaggcagccagcaaggaggacctgggacactatgaatgtgagttggtgaaccggttgggctcaacacgttgtggcggagaattatacatgcagagtcccgcactgcgtgcctgggaccagcaccaccgggaacagcttgtggctgctgtggaagacgcctccatggaggactctgcccaccccactcaggagggagctgaccaacaagccgcttctgtcctttggaggctgctgggctcagaagccctcagcccctccccagggggtttccccaacaccagacaaagtgagccacccacatcagaagaggctgctccccagatcccaggcacaacttcaggaacacctggcaaactcccagaggcttcacggcccggcacatacaaaggcctggagcaggggatgacaacaacttctggatcccaggaacggaatgtacccattcgggtggagggcacggcctggccaggcggaggcactgggcagctgctcttggatgtgcacagccaagtcatcatggagaccacacagaggacctatgtgtgccaagctcctgacacaggtgtcacaagggccccatccatgcaggtcactatcgaggacctacaagtacaagtgggtgacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtggaaggcctacactacctgcacagccatgatatcctccatctggacataaagccccccaacatcctgatggtccacccagctcgggaagacattaagatctgtgactttggctttgcccaaaagatcaccccgtcagagccacagtacagcaagtatggctcacctgaattcgtgtccccagagatcatcgagcagagtcctgtgagtgagggctcagacatctgggccatgggcgtcatctcctacctcagcctcacctgttcatccccattcgctggagagagtgaccgtgccaccctgctcaatgttttggaggggcgggtctcttggagcagtcccatggctgcccatctgagtgaggatgccaaggacttcatcaaggccacactgcaaaagacccccagggcccggcctagtgcttcccagtgccttgctcacccctggttcctgaagtccatgcctgctgaggaggcccacttcatcaacaccaaacagctcaagttccttcttgctcgcagtcgctggcagcgttccttgatgagctacaagtctatcctggtgatgcgctccatccctgagctgctccagggtcctccagacagtccatctctaggagtggcccggcacctacgaggggaagccagcggatcctctagctcatcgtcttcctcggacaatgagcttgccccatttgccagggctaagtcactgccaccttcccctgtcactcactcgccactgctgcaccctcggggctttctgcggccttcagccagcctcccggaggagacagaggccagcatgtccactgctgatgcagccatgccggcacccccccagagtgctgggcctccagcaagcccaggttgtgtgccccggcacagcgtcatcagcagcttgttctaccagcaagctggtgagggtgcagagcgtgggagcaaagcgttgggcgccaagaggcacccagctcggagacgccacctgctaaagggcgggtacattgcaagggccctgcccgggctacgagagccgctgatggagtttagtgtgttggaggaagaggctgctaatgaggagcaggcctctctgatgaccaagacaccctcctttgagaccgctctgcgactacctagttccaatgtcagagaggtcccaggccgaagccgctccctggacaacccaccaggcacagccagcccctctcctgaggcatacaaggaacaatacctgtccccaccctcctcggggttgactcatgaaaccaccgccaagggcatgggacacaaagaagggttcttgcaggagtctgtccccttttcacctaccagtggtgacctgaggcctgttaagcaagaggggtcatcccaggatagctgtagagggaaaccagcctcttcctgtcactctgaactgggttctggtccgcaggagggctgtggctctccatcatcacaattgtgtggctccttacctccacagtcatcgaagaaagagctctcaaaaccctgtggcccactcttttcagaacagcctcaggcagccccattcccagcgcaagcaagcccccttctgggttctcagaaggaacctcaggatagctatctacctgaaaagccatgtccagttccctccagttctccagggtcagcctcccaagtagatgcatccctggataccgaaggcttgtcggaagctggggacacatgtgacttcacgcctcctctccagcggcctcaggagcaggccaccacccggaagttctctctggaatcccgtgggggctatgcaggggtggcaggatatggcaccttcgcctttggtggggatgcaggggggatgttagggcagggtcccctttgggccaggatggcctgggctgtgtcccagtcctcagaagagcaagatgaagcagcgactgagagccctcaacctctggacagctcagggcccattgctgaggccagtggggttcccctaaggacctcgccaagcctcaccccatgggaggaagttgagcaggtttccctggtacagatccgggatctgtctggtgatgcagaagcagccgacaccatctccttggacatttcagaggtagatcctgcctacctcaacctctccgatctatatgacatcaagtatctcccgtttgagttcatgatcttcaggagggtccccaaacctgtagagcagccagagtcacctggctctgaaactgaagaggggcaagggctggcggagttcctggaggaggctgtgtggccctggccaggcgagctgggactgcgtgctggtctggagattacagaggagccacaggagccaggggacctggaagcactgctgggcgaggctgctgtgggcaggaagcgcaagtggtccccctcccgtggcctcttccaattccctgggaggtgcctgtcaggggaggagcccgtggagcttgggctgcgccagagggtgaaggcttccatggctcacatctccaggatcctgaagggcaagccggaaggtcctgagaaggaagggcctcccagaaagaaggcaggcctagcttctttccggctatcaggcctgaagggcagggaccaagcgccatccttcctaagagaactctctgatgaggctgtggtcctgggccaatcagtgacactggcctgccaggtgttggcccagccaactgcccaggctacctggagcaaagatggggcccttctggagagcagcggccacctcctcatctcttccaccctgaagaacttccagctgctgaccattctggtggtgacggaggaggatctgggcacatatacctgctgtgtgagcaacccactagggacagcagtcaccacaggtgtcctccggaaagcagagcgcccttcatcttctccacgcccggaggtgggggaactatacacggatgcagtgttgctggtctggaagcctgtggaatcctatggcccagtgacctacattgtgcagtgctgtatagaaggaggcagctggacaaccctggcctctgacatctccgactgctgctacctcactggcaagctgccccggggtggcatgtataccttccggacagcatgtgtcagcaaagcaggaatgggcccctacagtagcccctcagaacaggtcctccttggaggacccaaccacctggcttctgaggaggaaagcagccgggggagaccagcccagcttcttcccagcacaaagacttttgccttccagacacagatccggaggggccgcttcagtgtggtgaggcagtgtagggagaaagcaagtgggcgggccctggctgctaagatcgttccctaccagcctgaggacaagacaactgtactaagagaatatgaggcactaaagagactgcaccacccacatctggcccaactccatgctgcctacctcagtccccggcacctggtgctcatcctagagctgtgctctggccctgagctgctaccctctctggcggagagggactcgtactcagagtctgatgtgaaggactacctgtggcagatgctcagtgccacccagtacctgcatgcccaacacatcctgcacctggacctgaggtcggagaacatgatggtcaccgagtacaacctgcttaaggttatagacctgggtaacgcccagagtctcagccaagagaaggtcccacctcctgaaaacttcaaagactacctagagaccatggctccagaacttctggaaggccaaggggcggttccacagacagacatctgggctattggtgtaacagccttcattatgctgagtggcgagtacccagtgagcagcgaggggactcgcgacctgcagaaaggcctgcgcaagggactcattcaattgagtcgctgctatgcaggattatcagggggtgcggtagccttcctgcagagttcattgtgcgctcggccctggggtcgcccgtgcgcttccacctgcttgcagtgcgggtggctgacggaggagggccccaccggttcccggcccacgcccgtgaccttccccaccgcgcgattgcgtgcctttgtgcgcgagcgcgagaagcgccgggcgctactctacaagaagcacaacctggctcaggtgcgctgaggcccagccctacagagcaagatgtgcccgccaataaaagatgcaaaacagcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]