GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-28 07:09:19, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_039087250           25229 bp    mRNA    linear   ROD 22-FEB-2024
DEFINITION  PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and
            titin-interacting RhoGEF (Obscn), transcript variant X24, mRNA.
ACCESSION   XM_039087250
VERSION     XM_039087250.1
DBLINK      BioProject: PRJNA1074393
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_086028) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_036323735.1-RS_2024_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/09/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..25229
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /bio_material="RGD 61498"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /sex="male"
                     /tissue_type="kidney, spleen, liver"
                     /geo_loc_name="USA: Wisconsin, Milwaukee"
                     /lat_lon="43.05 N 88.04 W"
                     /collected_by="Rebecca Schilling, Melinda Dwinell"
     gene            1..25229
                     /gene="Obscn"
                     /note="obscurin, cytoskeletal calmodulin and
                     titin-interacting RhoGEF; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 1
                     mRNA, 22 ESTs, 84 long SRA reads, 32 Proteins"
                     /db_xref="GeneID:338458"
                     /db_xref="RGD:631335"
     CDS             186..25175
                     /gene="Obscn"
                     /codon_start=1
                     /product="obscurin isoform X24"
                     /protein_id="XP_038943178.1"
                     /db_xref="GeneID:338458"
                     /db_xref="RGD:631335"
                     /translation="
MDHSFSGAPRFLTRPKAFVVSVGKDATLSCQIVGNPTPHVSWEKDRQPVEAGARFRLAQDGDVYRLTILDLALGDSGQYVCRARNAIGEAFAAVGLRVDSEGTCAEQAPHFLLRPTSIRVREGADATFRCRVGGSPQPAVSWSKDGRRLGAPDAPHVRVEDRGEASALRIRSARPRDGGTYEVRAENPLGSASAAAALVVDSDAEAAGPPGTSVATLLAHLQQRREAMRAEGVPPSPPGAGTRTCTVTEGKHARLSCFVTGEPKPETVWKKDGQLVNEGRRHVVYEDEQENFVLKILFCKQSDRGLYTCTASNLVGQTYSSVLVVVREPAVPFKKRLQDLEVREKESATFQCEVAQPATEAAWFKEETRLWASAKYDIEEEGTERRLTVRNVSADDDAVYICETTEGSRTVAELSVKGNLTRKLPRKTAVRTGDTAIFWVELAVPEGPVQWLRNQEEMVAGGRIAITAEGTCHTLTIFQCTLEDMGEVAFVAGGCRTTTQFCVSAPRRPPLYPPADPVVKAKTESSVTLSWSPPPHGDRPVTIDGYVVEKRKLGAYAWSRCHEAEWLATTEFTIAGVAEEGDFQFRVSAINHFGHSPYLEFPGTMHLVPTLAVKTPLKAVEAMEGGEVTFSVDLTVASSGEWFLDGKALKESSTYVIRCDRTRHMLTIREVPASLHGAQLKFVANGIETSIQMVVRGALGLPSNKLPAVAAREVLAQLHEEAQLLAELSDQAAAVTWLKDGRELSLGPKYEMQVSAGKQALLVRDVAQDDAGLYECVSRGSRITYQLLVQEANLMFAKKQQARSEVKAEVGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRMEASGCSRRLVVQQVGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKGQQSHSKVKAEAGANATLSCEVAQAQTEVTWFKDGKKLSSSSKVCVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFCLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVSWFKDGKKLSSSSKVRMEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGANATLSCEVAEAQTEVSWFKDGKKLSSSSKLRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVMWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKLVFAKEQQACSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVCVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKLVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVPEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKLVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVTEPKVVFAKEQQARSEVKAEAGASATLSCEVAQAQTEVSWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPKVVFAKEQQACSEVKAEAGASATLSCEVAQAQTEVIWFKDGKKLSSSSKVRVEASGCSRRLVVQQVGKADAGEYSCEAGGQKVSFRLDVPDTKLMFAKEQQACSEVKAEAGASATLSCEVAQAQTEVTWFKDGKKLSSSSKVRVEASGCSRRLVVQQAGKADAGEYSCEAGGQKVSFRLDVAEPEPESQTPQRPSRREPLVIKEHETIVLSATIAAPSVAAVTWLKDGVEIRRSKRHETTSVGDTHTLTVRGAQVLDSAIYSCRVGKEGQDFPVQVEEVATKFSKPLEPVEGELGGTVTLVCELSPEQAEVVWRCGSTQLRAGKRFQMTAEGSRRTLTVSGLREDDAEEYVCESRDDRTSARLTVKVPRVVKFTSGLSAMAAEEGQEATFQCVVSPSDAAVMWYKDGTQLQPSEKFVMVQSGASRSLTILGLTLEDAGHVTVEAEGASSSAALRVREAPVLFKKKLEPQTVEERTPVTLEVELTRPWPEVKWTRNAAVLVPSENVEIHAEGARHRLVLRSVGFADRGFFGCETPDDKTQAKLNVEMRQVRLVRGLQEVEAKEQGTASMDVELSHADVEGSWTRDGLRLQPGPKCHLAVQGPVHILTLSALQPQDSGLVAFRAEGVHTSARLIVTELPVSFTRLLQDVVATQKEKVTLECELSRPVDVRWLKDGVELRAGKAIGIVAQGTCRSLVIYRCETGDQGVYVCDALDAQTSASLRVQGRSVQIMKPLEDVEVMEKEGATFSCEVSHDEVPGIWFREATKLRPSDNVRIRQEGRTYTLIFRRVLAEDAGEIKFVAENAESRAHLRVKELPVTLLRPLRDKIAMEKHRGVLECQVSRASAQVRWFKGKVELQPGPKYEVVSDGLYRKLVINDVQPEDEDTYTCDAGDVKTSAQFFVEEQSITIVRGLKDMTVMEPAPAWFECETSIPSVRPPKWLLGKTVLQAGGNVGLEQDGTVHRLTLHKTCSTMTGPVHFTIGKSRSTAQLVVSDIPVVLTRPLEPKAGRELQSVVLSCDFRPAPKAVQWYKEDTPLSPSEKFKMVLEGQMAELRILRLTPADAGVYRCQAGSAQSSAEVTVEAREVTVIQPLQDVEAMEEGRVCFSCELSHKDEDIEWSLNGTPLYSDSFHEISHEGCLHTLVLKSVRQADTGTVCATSPKVSVSARLVVKAKPVVFLKALDDVSAEERGTLTLQCEVSDPEARVVWRKDGVELGPSDKYDFLHKAGVRSLTVHDMSHEDAGLYTCQVGSKETQSRVSVHDLHVGITKRLKTVEVLEGESCSFECVLSHESPSDPAVWTVGGKIVRSSDHFQAVRQGRKYTLTVKDAALSDAGEVVFSVLGLTSKASLIIREKPVDITKPLEDQHTTPGEDVMLSCELSRAGSSVRWLKDGKAIRKSQKYDLLIEGTQAVLVVRKASLKDSGEYTCETEASRSTARLCVEEKTNRFTEELADLQVEEKGRAVFTCKTEQPASIVTWRKGLLELRASGKHVPSQEGLTLTLTINALERTDSDTYTCDIGQARTQARLLVHGQKVRVIEDLEDTAVQEGSSAKFCCRISPADYGPVHWFLDKTPLHSNELNEITVQSGGYHVLTLRQLTLKDSGTVYFEAGDQRTSAALRVTEKPSIFSRPLTDVTVTEGEDLTLVCETTTPDSSVRWTKDGKTLRPSARCQLNREGCQAQLVITGTTLQDGGRYKCEVGGASSSSIVRVHARPVRFRESLKDMEVPEGKAATLRCVLSSVAAPVEWRHGDDVLKSSNKYSLRQEGAVLELVIRDLKPQDSGQYSCSFGDQTTSATLTVKTSSAQFIGKLRNKEATEGTMATLRCELTKEAPVEWKKGTETLRNGDKYSLKQDGAVCELQICNLLVADAGEYLCVCGQEKTSATLTVKAVPVHFIRRLRNKEATEGDTVTLQCELSKAAPVEWRKGTETLRDGDRYSLKQDGAVCELQIRSLAVADAGEYLCMCGQEKTSATLTIRALPARFIEDLRSQEVPESSTVTMRCELSKKAPVVWRKGSETLKNGARYSLRQDGAVCELEIRDLTVEDAGEYSCTCGKERTSATLSIMAPQVVFQKLLENLQAEEGSTASLRCELSVPNTAVVWSKGGLELQADTCRETRQQGCVAELLLRDVRREDAGEYSCTCGSQTTSATLMVTAAPVRFLQELQAQDVDEGTTARLRCELSREAASVEWRKGSLQLFPCAKYQMVQEGTTAELLVHGVEQEDAGEYTCDAGHMQSIARLSVRAPKPKFKTGLQSKEQEAGGTARLCCQLSEAESGTPVQWLKEGVELHVSSKYEMRCQGAMCELLIHKLEAKDTGEYACVVGGQKTLASLRVKEPEVTIVQGLVDMEVQADEDVEFTCKVSQAGATDVQWHLQGLPLQSNEVTEVAVLGDGCTHVLQLKGVTLDDAGTVSFHVGSHSSSAQLIVRVPEVTVLEPLKDVQLSEGQDAHFQCRLSRASGQEARWALGGVPLQCNEMNDITVEQGTLYSLTLHKVTLEDAGTITLQVGSCSSEAQLKVTEAALCLVRGLQNVDVFAGEVATFSCEVSRAGGPEARWWLDGTLLQNSPESAMTVREGTVHSLTLSGLGVADSGTITFRTGPLVSTAKLLVKDPTVEVVSAMQDLVVEEGGSAELLCQYSRPVQAMWKMNEREVCADGHRVIIEQDWTVARLTLRPALPCDSGIYSCEAAGTRVVALLQVQAKNTVVRGLENVDALEGGEALFECQLSQPEVAAHTWLLDDEPVHTSANVEVVYFENGLRHLLLLKNLKPQDSCRVTFLAGDVVTSAFLTVRGWRLEVLEPPQDASVKAGTQVCFTCILSEALPVGEATWYINGAAIQPDDADWIVTADGSHHALTLSNAQPQHAGEVTFAARDAVASARLSVLALPGPPEDAEVVGRSDHSVTLSWVAPVSDGGGGLCGYRVEMKEASTGQWQLCHELVPGPECVVDGLVSGKTYRFRVAAVGPAGAGEPVHLPQMVKIAEPMEPKPAPAPAPALAPTPAPIPTPAPAPAPAPTPAPTPTPAPAPAPAPAPATRRAVVGEDVCLELEVAADAGEVVWHKGTERIHPSGHFEVLSQGQRQMLVIKGFRTEDQGEYRCGPIQGLPSSGASTFNVVVTSGSEDEVPAQPSLPPEAAQEGDLHLLWEALARKRRMSREPTLDSISELPEEDSRVQHLRQEAEEAAPDLSEGYSTADELARTGEADLSHTSSDDESRAGTPSLITYLKKAGGPGISPLASKHEAQVATSVKPQKQQERVVPTCPLPGDLNAADLKDPSLDKAAVKIQAAFKGYKVRKEMKQQGGPVFSRTFGDTEAQVGDALRLECVVSTKADVRACWLKDGVELTDGRHYHIDQLKDGTCSLLVTGLGPTDSGRYTCQVSTKFGSVSHSACVMVSGTESEAESSSGGELDDAFRRAARRLHRLFRTKSPAELSEEELFLSADEGPMEPEEPADWQTYREDENFVCIRFESLAEAHRAVTCFRDMFATMGIGVEISLGEQGPRGVEMRIGKVAPTVIPAVPLAKTPGLQTSDAAPVFLTELQNQDVQDGYPMSFDCVVTGQPVPSVRWFKDGKLLEEDDHYMINEDQQGGHQLIITAVVPADMGVYRCLAENSMGVSSTKAELRVELTSTDYDTAADATETSSYFSAQGYLSSREQEGTESDEGQLPQVLEELKDLQVAPGTRLAKFQLKVKGYPAPKLYWFKDGQPLTTSDHIRMTDKKTLHTLEIVSITREDSGQYAAYISNAVGAAYSSARLLVRGPSEPEEKPQPDVHERLVPPRILEKFTPKKVKRGSSITFSVKVEGHPAPSVHWLKEEAEKGVLWIGPDTPGYTMASSSKQHSLVLLDVGRQHQGTYTCIATNAAGQALCSASLHISGLAKEEEQERVKEALISSFLQGTSQAVSAQMSESASFADLVGQRKGESLVAEEAHSHLSLSEVGTEEFLQKLTSQITEMVSAKISQAKLQVPGGDSDEESKTPSASPRHGRSRPSSSVQESSSESEDGDSRGEIFDIYVVTADYLPLGAEQDAIILREGQYVEVLDSAHPLRWLVRTKPTKSSPSRQGWVSPAYLDKRLKLSPEWGPTEAPEFPGEAVSEDEYRTRLSSVIQELLSSEQAFVGELQFLESHHIKHLDRSPRVPAAVASQKTVIFRNVQDISHFHSSFLKELQSCGTDDDVAMCFIKNQEAFEKYLEFLVGRVQAESVVVSTPVQEFYKKYAEEMLSAKDPTQPPPPPLQHYLEQPVERVQKYQALLKELIRNKARNRQNCALLEQAYAVVSALPQRAENKLHVSLMENYPGTLEALGEPIRQGHFIVWEGAPGARMPWKGHNRHVFLFRNHLVICKPRRDSRTDTFSYVFRNMMKLNSIDLNDQVEGDDRAFEVWHEREDSVRKYLLQARTVIIKNSWVKEICGIQQRLAQPVWRPPEFEEELADCTAELGETVKLACRVTGTPKPIVSWYKDGKPVEVDPHHILIEDPDGSCTLILDNLTGIDSGQYMCFAASAAGNASTLGKILVQVPPRFVNKVRATPFVEGEDAQITCTVEGAPYPQIRWYKDGALLTLGNRYRMVNEPRSGMLVLVIQAASKEDLGHYECELVNRLGSTRCGGELYMQSPALRAWDQHHREQLVAAVEDASMEDSAHPTQEGADQQAASVLWRLLGSEALSPSPGGFPNTRQSEPPTSEEAAPQIPGTTSGTPGKLPEASRPGTYKGLEQGMTTTSGSQERNVPIRVEGTAWPGGGTGQLLLDVHSQVIMETTQRTYVCQAPDTGVTRAPSMQVTIEDLQVQVGDMAQFDAVIEGNPPPTVTWYKDSNQLVNGTRLRQQQGGTTYSLVLMDVTPHDAGVYTCVAQNAGGQVLCKAELLVYGGDKSDAEKQAYRRKLHSFYEVQEEIGRGVFGFVKRVQHKGNKMSCAAKFIPLRSKTRAQAYQERDILATLSHPLVTGLLDQFETQKTLILILELCSSEELLDRLFKKAVVTEAEVKVYIQQLVEGLHYLHSHDILHLDIKPPNILMVHPAREDIKICDFGFAQKITPSEPQYSKYGSPEFVSPEIIEQSPVSEGSDIWAMGVISYLSLTCSSPFAGESDRATLLNVLEGRVSWSSPMAAHLSEDAKDFIKATLQKTPRARPSASQCLAHPWFLKSMPAEEAHFINTKQLKFLLARSRWQRSLMSYKSILVMRSIPELLQGPPDSPSLGVARHLRGEASGSSSSSSSSDNELAPFARAKSLPPSPVTHSPLLHPRGFLRPSASLPEETEASMSTADAAMPAPPQSAGPPASPGCVPRHSVISSLFYQQAGEGAERGSKALGAKRHPARRRHLLKGGYIARALPGLREPLMEFSVLEEEAANEEQASLMTKTPSFETALRLPSSNVREVPGRSRSLDNPPGTASPSPEAYKEQYLSPPSSGLTHETTAKGMGHKEGFLQESVPFSPTSGDLRPVKQEGSSQDSCRGKPASSCHSELGSGPQEGCGSPSSQLCGSLPPQSSKKELSKPCGPLFSEQPQAAPFPAQASPLLGSQKEPQDSYLPEKPCPVPSSSPGSASQVDASLDTEGLSEAGDTCDFTPPLQRPQEQATTRKFSLESRGGYAGVAGYGTFAFGGDAGGMLGQGPLWARMAWAVSQSSEEQDEAATESPQPLDSSGPIAEASGVPLRTSPSLTPWEEVEQVSLVQIRDLSGDAEAADTISLDISEVDPAYLNLSDLYDIKYLPFEFMIFRRVPKPVEQPESPGSETEEGQGLAEFLEEAVWPWPGELGLRAGLEITEEPQEPGDLEALLGEAAVGRKRKWSPSRGLFQFPGRCLSGEEPVELGLRQRVKASMAHISRILKGKPEGPEKEGPPRKKAGLASFRLSGLKGRDQAPSFLRELSDEAVVLGQSVTLACQVLAQPTAQATWSKDGALLESSGHLLISSTLKNFQLLTILVVTEEDLGTYTCCVSNPLGTAVTTGVLRKAERPSSSPRPEVGELYTDAVLLVWKPVESYGPVTYIVQCCIEGGSWTTLASDISDCCYLTGKLPRGGMYTFRTACVSKAGMGPYSSPSEQVLLGGPNHLASEEESSRGRPAQLLPSTKTFAFQTQIRRGRFSVVRQCREKASGRALAAKIVPYQPEDKTTVLREYEALKRLHHPHLAQLHAAYLSPRHLVLILELCSGPELLPSLAERDSYSESDVKDYLWQMLSATQYLHAQHILHLDLRSENMMVTEYNLLKVIDLGNAQSLSQEKVPPPENFKDYLETMAPELLEGQGAVPQTDIWAIGVTAFIMLSGEYPVSSEGTRDLQKGLRKGLIQLSRCYAGLSGGAVAFLQSSLCARPWGRPCASTCLQCGWLTEEGPTGSRPTPVTFPTARLRAFVREREKRRALLYKKHNLAQVR"
     misc_feature    210..479
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    261..275
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    300..314
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    366..380
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    417..434
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    510..785
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    561..575
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    600..614
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    681..695
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    723..740
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    921..1163
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    942..956
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    981..995
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1059..1073
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1101..1118
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1140..1151
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1182..1433
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    1227..1241
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1263..1277
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1338..1352
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1380..1397
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1452..1661
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    1491..1505
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    1527..1541
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1602..1616
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1644..1661
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1671..1682
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    1722..1985
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:238020"
     misc_feature    order(1968..1973,1977..1982)
                     /gene="Obscn"
                     /note="Cytokine receptor motif [active]"
                     /db_xref="CDD:238020"
     misc_feature    2028..>2198
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    2313..2552
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    2349..2363
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2385..2399
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2460..2474
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2502..2519
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    2529..2540
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2583..2828
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    2625..2639
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2661..2675
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    2736..2750
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    2778..2795
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    2805..2816
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    2859..3104
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    2901..2915
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    2937..2951
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3012..3026
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3054..3071
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3081..3092
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    3135..3380
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    3177..3191
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3213..3227
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3288..3302
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3330..3347
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3357..3368
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    3411..3656
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    3453..3467
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3489..3503
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3564..3578
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3606..3623
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3633..3644
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    3687..3932
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    3729..3743
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    3765..3779
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    3840..3854
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    3882..3899
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    3909..3920
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    3963..4208
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    4005..4019
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4041..4055
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4116..4130
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    4158..4175
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    4185..4196
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    4239..4484
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    4281..4295
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4317..4331
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4392..4406
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    4434..4451
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    4461..4472
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    4515..4760
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    4557..4571
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4593..4607
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4668..4682
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    4710..4727
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    4737..4748
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    4791..5036
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    4833..4847
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    4869..4883
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    4944..4958
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    4986..5003
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5013..5024
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5067..5312
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    5109..5123
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5145..5159
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5220..5234
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5262..5279
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5289..5300
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5343..5588
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    5385..5399
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5421..5435
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5496..5510
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5538..5555
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5565..5576
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5619..5864
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    5661..5675
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5697..5711
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    5772..5786
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    5814..5831
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    5841..5852
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    5895..6140
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    5937..5951
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    5973..5987
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6048..6062
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6090..6107
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6117..6128
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6171..6416
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    6213..6227
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6249..6263
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6324..6338
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6366..6383
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6393..6404
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6447..6692
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    6489..6503
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6525..6539
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6600..6614
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6642..6659
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    6669..6680
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    6744..6944
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    6771..6785
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    6810..6824
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    6885..6899
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    6927..6944
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    7002..7244
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    7041..7055
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    7077..7091
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    7152..7166
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    7194..7211
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    7221..7232
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    7263..7514
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    7311..7325
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    7347..7361
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    7422..7436
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    7464..7481
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    7491..7502
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    7533..7784
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    7578..7592
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    7614..7628
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    7689..7703
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    7731..7748
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    8064..8312
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    8112..8126
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    8145..8159
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    8220..8234
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    8262..8279
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    8289..8300
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    8328..8579
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    8376..8390
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    8415..8426
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    8487..8501
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    8529..8546
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    8601..8846
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    8646..8657
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    8679..8693
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    8754..8768
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    8796..8813
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9132..9383
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    9180..9194
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    9219..9230
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    9291..9305
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    9333..9350
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9402..9650
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    9450..9461
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    9483..9497
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    9558..9572
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    9627..9638
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    9666..9917
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    9714..9728
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    9750..9764
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    9825..9839
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    9867..9884
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    9936..>10142
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    9981..9995
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    10023..10037
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    10098..10112
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    10239..10457
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    10254..10268
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    10290..10304
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    10365..10379
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    10407..10424
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    10434..10445
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    10473..10724
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    10521..10535
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    10557..10571
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    10632..10646
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    10746..10997
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    10788..10802
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    10827..10841
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    10905..10919
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    10974..10985
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    11016..11264
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    11061..11075
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    11097..11111
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    11172..11186
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    11214..11231
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    11241..11252
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    11280..11531
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    11328..11342
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    11367..11378
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    11442..11453
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    11508..11519
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    11547..11795
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    11595..11609
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    11628..11642
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    11703..11717
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    11745..11762
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    11772..11783
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    11811..12059
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    11859..11873
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    11892..11906
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    11967..11981
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    12009..12026
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    12036..12047
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    12075..12323
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    12123..12137
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    12159..12170
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    12231..12245
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    12273..12290
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    12300..12311
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    12339..12590
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    12387..12401
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    12423..12437
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    12498..12512
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    12540..12557
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    12567..12578
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    12606..12857
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    12654..12668
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    12690..12704
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    12765..12779
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    12807..12824
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    12834..12845
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    12906..13130
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    12921..12935
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    12963..12977
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    13038..13052
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    13080..13097
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    13107..13118
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    13149..13406
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    13194..13208
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    13233..13247
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    13308..13328
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    13413..13679
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    13470..13484
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    13509..13523
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    13587..13601
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    13656..13667
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    13701..13916
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    13743..13757
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    13782..13796
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    13860..13874
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    13986..14186
                     /gene="Obscn"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:214653"
     misc_feature    14235..14492
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    14508..14768
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    14556..14570
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    14598..14612
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    14676..14690
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    14718..14735
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    14745..14756
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    14778..15035
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:238020"
     misc_feature    order(14778..14780,14973..14975,15018..15020)
                     /gene="Obscn"
                     /note="Interdomain contacts [active]"
                     /db_xref="CDD:238020"
     misc_feature    order(15021..15026,15030..15035)
                     /gene="Obscn"
                     /note="Cytokine receptor motif [active]"
                     /db_xref="CDD:238020"
     misc_feature    15225..15410
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    15246..15260
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    15282..15296
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    15357..15371
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    16020..16292
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    16071..16085
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    16110..16124
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    16188..16202
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    16230..16247
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    16269..16280
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    16710..16982
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    16761..16775
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    16800..16814
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    16878..16892
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    16920..16937
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    16959..16970
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    17106..17378
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    17157..17174
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    17199..17213
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    17274..17288
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    17316..17333
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    17355..17366
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    17439..17726
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    17490..17504
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    17529..17543
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    17622..17636
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    17664..17681
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    17703..17714
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    18132..18320
                     /gene="Obscn"
                     /note="Src homology 3 domain of Obscurin and similar
                     proteins; Region: SH3_Obscurin_like; cd12025"
                     /db_xref="CDD:212958"
     misc_feature    order(18153..18155,18159..18161,18183..18188,18237..18245,
                     18294..18296,18300..18302,18306..18311)
                     /gene="Obscn"
                     /note="peptide ligand binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:212958"
     misc_feature    18417..18947
                     /gene="Obscn"
                     /note="Guanine nucleotide exchange factor for
                     Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous
                     (DH) domain. It appears that PH domains invariably occur
                     C-terminal to RhoGEF/DH domains; Region: RhoGEF; cl02571"
                     /db_xref="CDD:470622"
     misc_feature    order(18426..18428,18438..18440,18804..18809,18816..18821,
                     18825..18830,18837..18842,18849..18854,18861..18863,
                     18939..18941)
                     /gene="Obscn"
                     /note="GTPase interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:238091"
     misc_feature    18972..19346
                     /gene="Obscn"
                     /note="Obscurin pleckstrin homology (PH) domain; Region:
                     PH_Obscurin; cd13239"
                     /db_xref="CDD:270059"
     misc_feature    19368..19640
                     /gene="Obscn"
                     /note="First immunoglobulin-like domains A168 within the
                     A-band segment of human cardiac titin, and similar
                     domains; a member of the I-set of IgSF domains; Region:
                     IgI_1_Titin-A168_like; cd20971"
                     /db_xref="CDD:409563"
     misc_feature    19383..19403
                     /gene="Obscn"
                     /note="Ig strand A' [structural motif]; Region: Ig strand
                     A'"
                     /db_xref="CDD:409563"
     misc_feature    19416..19442
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409563"
     misc_feature    19458..19475
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409563"
     misc_feature    19482..19490
                     /gene="Obscn"
                     /note="Ig strand C' [structural motif]; Region: Ig strand
                     C'"
                     /db_xref="CDD:409563"
     misc_feature    19506..19529
                     /gene="Obscn"
                     /note="Ig strand D [structural motif]; Region: Ig strand
                     D"
                     /db_xref="CDD:409563"
     misc_feature    19536..19556
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409563"
     misc_feature    19575..19601
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409563"
     misc_feature    19608..19640
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409563"
     misc_feature    19650..19919
                     /gene="Obscn"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    19701..19715
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    19740..19754
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    19821..19835
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    19863..19880
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    19902..19913
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    20412..20681
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    20463..20477
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    20502..20516
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    20577..20591
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    20619..20636
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    20658..20669
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    20733..21503
                     /gene="Obscn"
                     /note="The protein kinase superfamily is mainly composed
                     of the catalytic domains of serine/threonine-specific and
                     tyrosine-specific protein kinases. It also includes RIO
                     kinases, which are atypical serine protein kinases,
                     aminoglycoside phosphotransferases; Region: Protein
                     Kinases, catalytic domain; cl21453"
                     /db_xref="CDD:473864"
     misc_feature    order(20760..20771,20778..20780,20784..20786,20823..20825,
                     20829..20831,20913..20915,20961..20972,21099..21101,
                     21111..21116,21120..21122,21156..21161)
                     /gene="Obscn"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:271009"
     misc_feature    23652..23900
                     /gene="Obscn"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:400151"
     misc_feature    23703..23717
                     /gene="Obscn"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    23742..23756
                     /gene="Obscn"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    23817..23834
                     /gene="Obscn"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    23862..23879
                     /gene="Obscn"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    23904..23915
                     /gene="Obscn"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    23934..24170
                     /gene="Obscn"
                     /note="Fibronectin type 3 domain; Region: FN3; smart00060"
                     /db_xref="CDD:214495"
     misc_feature    24270..25040
                     /gene="Obscn"
                     /note="The protein kinase superfamily is mainly composed
                     of the catalytic domains of serine/threonine-specific and
                     tyrosine-specific protein kinases. It also includes RIO
                     kinases, which are atypical serine protein kinases,
                     aminoglycoside phosphotransferases; Region: Protein
                     Kinases, catalytic domain; cl21453"
                     /db_xref="CDD:473864"
     misc_feature    order(24300..24311,24318..24320,24324..24326,24363..24365,
                     24369..24371,24453..24455,24501..24512,24639..24641,
                     24651..24656,24660..24662,24690..24695)
                     /gene="Obscn"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:271012"
     polyA_site      25229
                     /gene="Obscn"
                     /experiment="COORDINATES: polyA evidence [ECO:0006239]"
ORIGIN      
gcctgtcctttcgtccctgtccagtctgaggaccggctggagtgtgggctgctgggtgggaaccacgtcgtcctgggccccaggaaggaggcagacccagcagccccccaactcaccatctgtgccccttgcctgggtgctgccccaacccctggtagacacagtcccccaaccctgctaacatcatggaccactccttcagcggagcaccccgcttcctgacgcggccaaaggcttttgtggtatctgttggcaaggatgccacgctgagctgccagatcgtgggcaaccccacgccacacgtgagctgggagaaggaccggcagccagtggaggcaggagcacgcttccgcctggcccaggacggggatgtgtaccgcctcaccatcctcgatctggctctaggtgacagcgggcagtacgtgtgtcgagcgaggaacgccataggggaggccttcgccgctgtaggtttgcgagtggactcggagggcacgtgtgccgagcaggcgccccactttctgctgcggcccacctccattcgtgtgcgcgagggcgcagacgccaccttccgatgtcgcgtcggcggctcaccgcaacctgctgtgagctggtccaaagatgggcggcgcctaggtgcaccagatgccccccacgtgcgcgtggaagatcgcggagaggcgagcgcgcttcgcatccggtcggcaaggcctcgcgatggtggcacctacgaagttcgagcagagaacccactgggctccgccagcgctgccgccgctctcgtggtggactcggatgccgaggctgccggaccacccggaacctccgttgccacgctcctggcgcacctgcagcagcggcgcgaggccatgcgcgcagagggcgtccctccttctccacctggtgctggcacgcgcacctgcacggtgaccgaaggcaaacacgcgcgcctcagctgctttgtgaccggcgagcccaagcccgagacagtgtggaagaaggacgggcagctggtgaacgagggccggagacacgtagtatatgaggatgagcaagagaacttcgtccttaagattcttttttgcaagcagtctgatcgcggcctctacacttgcacagcatccaacctcgtgggccagacctacagctcggtgctggtggtcgtgagagagcctgcggtgcccttcaagaagcggctgcaggacctggaggtgcgagagaaagagtctgccacattccagtgtgaggtggctcagccagccaccgaggcggcgtggttcaaggaggagacccggctatgggccagcgccaagtacgacatcgaggaggagggcaccgagcgccggctgactgtgcgcaacgtctcggcagacgacgacgcggtgtacatctgcgagaccacagagggcagccgcacggtggcagagctctcagttaaaggaaacttgaccagaaagctgcctcggaaaacagcagtgaggactggagacacagccatcttttgggtggagctggctgtccccgaaggccctgtccagtggctacggaaccaggaggagatggtggcagggggcaggattgccatcactgcagaaggcacttgccacacactgaccatcttccagtgcaccttggaggacatgggtgaggtggccttcgtggctggtggctgcagaacgactacccagttctgtgtatcagcacccaggaggccacccctgtaccctcctgctgaccctgttgtgaaggccaagacagagagttctgtgacccttagctggtccccaccaccccatggggaccgccctgtcactattgatggttatgtggtggagaagaggaagctgggtgcctatgcctggagcaggtgtcatgaagcagaatggctggccacaactgagtttactattgctggcgtggctgaggaaggggacttccagttccgagtgtcagccatcaatcactttggccacagtccttaccttgagtttccagggaccatgcacttggtccccacgctggctgtaaagacacctctgaaggcggtggaggccatggagggtggtgaggtcactttctccgtggacctcacggtggcgtcttcgggtgagtggttcctggacgggaaggccttgaaagagagcagtacatacgtgatccgttgtgaccgtacccggcacatgctcaccatcagagaggtgcctgccagcttgcacggggcacagctgaagtttgtggctaatggcattgaaaccagcatccaaatggtggtccgaggggctctggggctgcccagcaacaagcttcctgccgtggctgcccgggaggtgctggcccagctgcatgaggaggcacagctgctggctgagctgtcagaccaggctgcggctgtgacttggctaaaggatggtcgtgagctgtccctaggacccaagtatgagatgcaggtgtcggctgggaagcaagcactgctggtgcgggatgtggcacaggatgacgctgggctctatgagtgtgttagtcgtgggagccgcatcacctaccagctgttggtgcaagaggccaatttgatgtttgccaagaagcagcaggcacgcagcgaggtgaaggcagaggttggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcatggaggcctcgggctgctccaggaggctggtggtgcagcaggtgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggggcagcagtcacacagcaaggtgaaggcagaggcaggggccaatgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctccaaggtgtgtgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttctgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcaggagccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgtcatggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcatggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtcacagaacccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccaatgccacactgagctgcgaggtggccgaggcccagactgaggtgtcatggttcaaggacgggaagaagctgagctccagctccaagctgcgtgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagaacccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggatgtggcagaacccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcgggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggctcgcagcgaggtgaaggcagaggcgggggccagtgccacactgagctgcgaggtggcccaggcccagactgaagtgatgtggttcaaggacgggaagaagctgagctccagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaagctggtgtttgccaaggagcagcaggcatgcagtgaggtgaaggcagaggccggggccagcgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcagatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctctagctcgaaggtgtgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggacgtagcagagcccaagctggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacgtggttcaaggacgggaagaagttgagctctagctccaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaagcgggcaaggcagatgctggagagtacagctgtgaggccgggggacagaaggtctccttccgcctggatgtgccagagcccaaggtggtgtttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggacgggaagaagctgagctccagctccaaggtgcgagtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggacgtcacagagcccaagctggtatttgccaaggagcagcaggcacgcagcgaggtgaaggcagaggctggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgtgaggccgggggacagaaggtctccttccgcctggacgtcacagagcccaaggtggtgtttgccaaggagcagcaggcacgcagtgaggtgaaggcagaggcaggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgtcgtggttcaaggacgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtggcagagcccaaggtggtgtttgccaaggagcagcaggcatgcagcgaggtgaaggcagaggcaggggccagtgccacactgagctgcgaggtggcccaggcccagactgaggtgatatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcaggctgctccaggaggctggtggtgcagcaggtgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgtctggatgtgccagacaccaaacttatgtttgccaaggagcagcaggcatgcagcgaggtgaaggcagaggccggggccagtgccacactgagctgtgaggtggcccaggcccagactgaggtgacatggttcaaggatgggaagaagctgagctccagctcgaaggtgcgcgtggaggcctcgggctgctccaggaggctggtggtgcagcaggcgggcaaggcggatgctggggagtacagctgcgaggccgggggacagaaggtctccttccgcctggacgtggcagaaccagagcctgagtcccaaactccacagaggcctagccgcagggagcctctggttatcaaggaacatgagaccattgtcctgagtgccacgatagctgcaccctctgtggctgctgtgacctggctcaaagacggcgtggagatccgccgcagcaagcggcatgagaccaccagtgtgggtgatactcataccctgactgtgagaggtgcacaggttctggacagtgccatctacagctgccgtgtcggcaaggaaggtcaggacttcccggtgcaggtagaagaggtggccaccaagttctccaaacccctggagcctgtggaaggggaattgggtggcactgtgacgctggtctgtgagctgagcccggaacaggctgaggttgtgtggcgctgtgggagcacacagctgcgggcgggcaagcgcttccagatgacagctgaggggtctaggcgcacactgaccgtgtctggccttcgagaggacgacgcagaggagtatgtgtgtgagagccgggatgaccgcaccagtgcacggctcactgtcaaagttccccgagtggtcaagtttacatccggattgagtgccatggcggcagaggagggccaagaggccacctttcagtgtgtcgtgtcccccagcgatgcagcagtcatgtggtacaaggacggcacgcagctgcagcctagcgagaagtttgttatggtgcagagtggggccagccgaagcttgactatcttgggcctgaccctggaggatgctgggcatgtcactgtggaggctgagggtgcttcatcatctgctgccctccgggtccgagaggcaccagtcctcttcaaaaagaagcttgagccacagacggtggaggagaggacccctgtgaccctggaagtagagctgactcgcccctggcccgaggtgaagtggacgcggaatgctgccgtcctggtacccagcgagaacgtggaaatccacgctgagggtgcccggcaccgtctggtgctgcgaagcgtgggcttcgctgaccgtggcttctttggctgtgagacaccagatgacaagactcaggccaagctcaacgtagaaatgcggcaggtccggctggttcgaggtttgcaggaggtggaggctaaggaacagggcacagcctcgatggatgtggaattgtcccatgctgacgtggaaggcagctggactcgagatggcctgcgacttcagccggggcccaaatgccacctggccgtacaaggccctgtccacatcctcacactctcagcgctgcagccacaggacagcgggttggtggccttcagggctgagggcgtgcacacgtctgcacggctcatagtcactgagttgcccgtgagcttcaccagactgctacaggatgtggtggccactcagaaggagaaggtgaccctggagtgtgagttgtcacggcccgtcgatgtgcgctggctgaaggatggtgtggagctgcgggcaggcaaggccataggcatagtggctcagggaacctgcaggagtctcgttatctaccggtgtgagactggggaccagggcgtctatgtatgtgatgctctggatgctcagacctctgcctctctgagggtgcagggacgcagtgttcagattatgaagcccctagaggatgtggaggtgatggagaaggagggtgccacattctcctgtgaggtgtcccatgatgaggttcctggcatatggttccgagaagccactaagctacggcccagtgacaatgtgcgcatccggcaggaagggaggacatatactctcatcttccggagggtactggcagaagatgcgggggagatcaagtttgtagctgaaaatgcagaatcaagggctcacctccgagtgaaagaactgcctgtgaccctcctgcgcccactacgggacaagattgccatggaaaaacaccgtggcgtgcttgagtgccaggtgtcccgggctagtgcccaggtgcggtggttcaagggcaaagtcgagctgcagcctgggcccaagtatgaggtggtcagcgacggcctttaccgcaaactggtcatcaatgatgtgcagcccgaggacgaagatacttacacctgtgatgctggcgatgtgaagaccagtgcccagttcttcgtggaagagcaatccatcactattgtgcgggggctgaaggacatgacagttatggagcctgcccctgcctggtttgaatgtgagacctccattccttctgtgaggccacccaagtggctccttggtaagactgtgctacaggcaggggggaacgtggggctggagcaagacggtactgtgcaccgactgacacttcacaagacctgctctaccatgaccgggcctgtgcacttcaccatcggcaagtcccgctccactgcccagcttgttgtctcagacattcctgtggtattgacaaggcctctggagcccaaagcagggcgcgagctgcagtcggtcgtcctgtcctgtgacttcaggccagcccccaaggctgtgcagtggtacaaggaggatacacctctgtccccgtcagaaaagttcaagatggtgctggagggccagatggcagagctgcgtatactccggcttactccagctgatgctggggtctaccggtgccaggcgggtagtgcccagagcagtgccgaggttactgtggaagctcgggaggtgacagtgatccagccactgcaggatgtggaagccatggaggaaggccgggtctgcttctcctgtgagctatctcataaggacgaggatatcgaatggtcactcaatggtacacccctgtactcggacagcttccacgagatcagccatgagggctgtctccacacgctggtgctgaagagtgtccggcaggctgacacgggcaccgtgtgtgccacctctcccaaggtgtcagtttctgcccggctggtggttaaagcaaagccagtggtgttcctaaaagcactggatgacgtatctgcagaagagcggggcacgctgaccctgcagtgcgaggtctccgacccggaggcgcgtgtggtttggcgcaaagatggtgtggagttgggtcccagcgacaagtatgacttcctacacaaggcaggtgttcggagccttacggtccatgacatgagccacgaggatgctggactgtacacctgccaggtgggcagtaaggagacccagtccagggtcagcgtgcatgaccttcatgtgggcatcaccaagaggttaaagacggtggaggtgctggagggagagagctgcagctttgagtgtgtcctctcccatgagagtcccagtgacccagcagtgtggacagttggtgggaagatagtgcgtagttctgaccacttccaggccgtacggcagggccgcaaatacactctgacagtcaaagatgctgccctcagtgatgcaggagaggtggtcttctcagtgctgggcctcacatccaaggcctcgctcatcatcagagagaagccagtggacatcacaaagcccctggaggaccagcacactacgcctggggaagatgtgatgctaagctgcgagctctctagggcaggctcctccgtgcgctggctgaaagacgggaaggccatccggaagagtcagaagtatgacctgctcattgaaggcacacaggctgtgttggttgtccgaaaggcctcgctcaaggattctggagaatacacctgtgagacagaagcctccagaagcactgccaggctgtgtgtggaagaaaagacaaaccggttcacggaggagctggctgacctgcaggtagaagagaagggcagagctgtgttcacatgcaagacagagcaaccggcatctattgtgacctggcgcaaaggcctcctggagctgcgcgcctcagggaagcatgtccccagccaggagggtttgaccctgacgcttactatcaatgccctggagaggacagacagtgacacttacacctgtgacattggccaagcccggacccaggcccggctcctcgtccatggccagaaagtacgagtcattgaggacctagaggacaccgctgtccaggagggctcctctgccaagttttgctgccgcatctcccctgctgactacggccctgtgcactggttcctggataagacccctttgcacagcaacgagctgaacgagatcactgtccagtccggaggctaccacgtgctcaccctgcggcagctgacgctcaaggattcaggcacggtctacttcgaggcgggtgaccagcggacctcagctgccctgcgggtgactgagaagccgagcatcttctctcggccactcacagatgtcacagtcacagaaggcgaggacctgactctcgtctgtgaaaccaccaccccggatagctctgtgcgctggaccaaagatgggaagacactgaggccatctgcacgatgccagctgaaccgcgaaggctgtcaggcccagctggtcatcactggcactaccctacaggatggcgggcggtacaaatgtgaggtgggcggagcctccagcagctccattgtcagggttcacgctcggccagtgcggttcagggagtccctgaaggacatggaggtgccagagggcaaggctgccacactacgctgtgtgctgtcatccgtggctgcacctgtggagtggcgtcacggagatgatgtcctgaaatccagcaacaagtatagcctgcgccaagagggtgctgtgctggaactggtcatccgagacctgaagccccaggacagcgggcagtactcatgctcctttggggaccagacaacttcagccacactcacagtgaaaacctcgtctgcccagttcataggaaaactgagaaacaaggaggccacagaagggaccatggccacacttcggtgtgagctgaccaaagaggcccccgtggaatggaagaagggaacagagaccctgagaaatggggacaaatacagtctgaagcaggatggagctgtgtgtgaactgcagatctgtaacctgcttgtggcagacgcgggggagtacttgtgtgtatgcgggcaggagaagacttcagccacgctgactgtcaaggccgttcctgtccactttatcagaaggctcaggaacaaggaggccacagaaggggacacggtcacactgcagtgtgaactgagcaaggcggcccccgtggagtggaggaagggaacagagaccctgagagatggggacagatacagcctgaagcaggatggggccgtgtgtgagctgcagatccgcagcctggctgtagcagatgctggagagtacttgtgcatgtgtggacaggaaaagacctcagccacactgaccatcagggcccttccagccagattcatagaagatttgagaagccaagaggtcccggaaagttcaacagtcacaatgcggtgtgagctaagcaagaaggcccctgtggtgtggaggaaagggtctgagaccctgaaaaatggggccaggtacagcctgagacaggatggtgctgtgtgtgagctggagatccgtgacctgactgtggaagatgctggagagtactcatgcacatgtgggaaggagaggacctcagccacactgagcattatggctccacaggtggtgttccagaagttactggagaatctgcaagcagaagaaggctccacagccagcctgcggtgtgagctgtcagtccccaacactgctgtggtctggagcaagggcggcctggagctgcaggctgacacatgccgagagacacggcagcagggctgcgttgcagaactgctgcttagggacgtgcgccgtgaggacgcgggcgagtacagctgtacctgtggttcccagaccacaagtgccacactcatggtcacagctgctcctgtgaggttcctccaggagctacaggcccaggacgtagatgaagggaccaccgcacgcctgcgctgtgagctgagccgggaggctgcgagtgtggaatggcgcaagggctccttgcagctttttccttgtgctaagtatcagatggtgcaggagggcacaactgcagagctgctagtccatggggtggagcaggaggatgcaggggaatacacctgcgatgcaggacacatgcagagcattgccaggctctccgtccgagcccccaagcccaagttcaagaccggcctacagagcaaagagcaagaagcaggtggcacagcacggctgtgttgtcaactgagcgaagctgagtcggggactccagtacaatggctcaaagagggggtggagctgcatgtcagctccaagtacgagatgcggtgccaaggggctatgtgtgagttgctgatccacaagctggaggccaaggacactggtgaatatgcctgcgtggtgggtggccagaagaccttggcctccctcagagtcaaagagcctgaggtgaccattgtgcagggactggtggacatggaggtgcaggctgatgaggatgtggagttcacttgcaaggtgtcacaggcaggagccacagatgtgcagtggcatctccaaggtctgccactgcagagcaatgaagtgacagaggtggctgttcttggagacggctgtacccatgtgctccagttgaagggtgtgacactggatgatgctggtactgtctccttccacgtgggcagccattcatcttctgctcagctcatagtccgagtccccgaggtgaccgttctggagcccctgaaggatgtgcagctcagcgagggccaggatgcccatttccagtgccggctgtccagggcttcgggccaggaggctcgctgggctttgggaggagttcccttgcagtgcaatgagatgaatgacatcactgtggagcagggcacactctactcgctcactctgcacaaggtgaccctcgaggatgccggaaccatcactctccaagtgggctcatgctcctcagaggcccagctgaaggtcacagaggcagcactgtgcctggtacgaggcttgcagaatgtggatgtcttcgcgggggaggtggccacgttctcctgtgaggtatctcgagcaggtgggccagaggcccgctggtggctggatggcaccctgcttcagaacagccctgagagtgccatgactgtacgagagggtactgttcactccctcacgctctcgggcctgggggtggctgactcaggcaccatcaccttccgcacggggcccctggtctccacagccaagttattggtcaaagatcccacagtggaggtggtgagtgccatgcaggacctggtggtggaggagggtggctcggccgagctcctctgccagtactcgcggcccgtgcaggccatgtggaagatgaacgagcgggaggtgtgcgcggatgggcaccgtgtcatcatagagcaggactggaccgtagccaggctgaccctcaggccggccctgccctgtgacagtggcatctattcttgtgaggctgcgggcactcgagttgtggcactgctccaagtgcaagccaagaacacagtggtgcgtggcctggagaatgtggatgcactggagggcggcgaagctctgttcgagtgtcagctgtcccagccggaagtggctgcccacacctggttactagacgatgagcctgtgcacacatcagcaaacgtggaggtggtctactttgagaacggactgcgccacttgcttttgctcaaaaacctgaagccacaggacagctgccgagtgaccttcctggcaggggacgtggtcacgtctgccttcctcactgtgagaggctggcgcttggaggtcctggagcccccacaagacgcatctgtgaaagctggtacgcaggtctgcttcacttgcatactaagtgaggccctgcctgtgggcgaggctacttggtacatcaacggggctgccatccaacctgatgacgctgactggatagtcaccgcagatggcagccaccatgccctgacgctgagcaacgcccagccccagcacgcaggagaggtcacatttgcagcacgtgacgccgtggcctctgcacgcctctctgtgttggctctccctggtccccctgaagatgctgaagtagtgggtcgaagtgaccactctgtgaccctatcctgggtggctcccgtgagtgacggcggcggcggtctatgtggttatcgtgtggagatgaaggaggcatccacaggccagtggcagttgtgccatgagttggtacctggcccagagtgtgtggtggacggcctggtctctgggaagacctaccgcttccgagtggcagccgtgggtccggcaggagctggggagcctgtacatctgccccagatggtcaagatagcagagccaatggaacctaaaccagccccagccccagcccctgccctagccccaaccccagctccaatcccaaccccagccccagccccagccccagccccaaccccagccccaaccccaaccccagccccagccccagcccctgccccagccccagcaacacggcgagcagtggttggtgaagatgtgtgtctggagctggaagtggcagctgatgctggcgaggtcgtctggcacaagggaacagagcgcatccatcccagtgggcactttgaggtcctctctcagggtcagcggcagatgctggtgatcaagggctttaggaccgaagaccagggggagtaccgctgtggtcccatccagggcctgccctcctcaggagcttctactttcaatgtggtcgtgacctcgggctcggaggatgaggtccctgcacagcccagcctgcctcccgaggcagcccaggagggtgacctgcatctgctttgggaggcccttgctcggaagcgtcgcatgagccgggagcccacgctggactccatcagtgagctgcccgaggaagacagccgtgtgcagcatctgcggcaggaggcagaagaggcggctcctgacctctctgagggctactccacagccgatgagctcgcacgcacaggagaagctgacctctcacacaccagctctgatgacgagtctcgggctggcaccccttccctaattacctacctcaagaaggccgggggtcctgggatctcacccttggccagcaagcatgaggcccaggtggccacgtctgtgaagccacaaaagcagcaggagcgggttgtgcccacatgcccactgccgggagatttgaacgcagcagatttgaaggatccatccctggacaaggccgctgtgaagatccaggctgcctttaagggctacaaagtgaggaaggagatgaagcagcagggaggccccgtgttctcacggacatttggggacacagaggcacaggttggggatgcgctgcggctggagtgtgtggtgtccaccaaggctgacgtgcgggcctgctggttgaaggatggcgtagagttaacagatgggcgccattaccacatagaccagctcaaggacggtacctgctctctgctggtcactggcctgggccccactgactctggtcgctacacctgtcaggtgagcaccaagtttggaagcgtgagccacagtgcctgcgtaatggtcagtgggacagaaagtgaggctgagagctcctcaggaggtgagctggacgatgccttccgccgggcagcacgacgcctgcatcgtctcttccgaaccaagagcccagctgagctttcagaagaggagctcttcctcagtgctgacgaaggccccatggagccagaggagcctgcagactggcaaacataccgagaggatgaaaactttgtgtgcatccgttttgagtcacttgcagaggcccaccgggcagtcacctgcttccgtgacatgtttgccaccatgggcatcggggtggagatcagcctaggggagcaggggccccggggagtggagatgcgcattggcaaggtggcccccactgtcatccctgcggtgccacttgcaaagacacctggcctgcagacttcagatgctgccccagtgttcctgacggagctgcagaaccaagacgtgcaggacggataccccatgagcttcgactgcgtggtaacaggccagcctgtgcccagtgtgcgctggttcaaggacgggaagttgctagaagaggatgaccactacatgatcaacgaggaccaacaggggggtcaccagctcatcatcacagccgtggtgccggcagacatgggagtgtaccgctgcctggcggagaacagcatgggcgtctcctccaccaaggctgagcttcgtgtggaattgaccagcacagactatgacactgctgctgatgctaccgagacctcatcctacttcagcgcccagggatacctgtccagccgggagcaagaggggacggagtcagatgaggggcagcttccccaggtgctggaggaactgaaagacctccaggtggcccctggcacacgcctggccaagttccagctcaaggtgaaaggttatccagctcccaaactgtactggttcaaagatggccagcccctgaccacatctgaccacatccgcatgactgacaaaaagaccctgcacaccctggagattgtctccatcacccgagaggacagcggccagtacgcggcctacatcagcaatgctgtgggtgccgcctattcgtcagcccggctgctggtccgaggtcccagtgaaccagaagagaagccacaaccagatgttcatgagaggctggtgccaccccgaatcctggagaagttcacccccaagaaagtgaagaggggctccagcatcaccttttcagtgaaggtggaaggacacccggcccccagtgtgcattggctcaaggaggaggcagagaagggagtcctgtggattggccctgatacccctggctacacgatggccagttcttccaagcaacatagcctggtcctgctggacgtaggccgacagcaccagggcacctacacgtgcattgccaccaatgctgctggccaggcgctctgctctgccagtctgcacatctctggcttggccaaagaagaggagcaggagagagtgaaggaggctctcatttcctccttcctgcaagggacgagccaagctgtctcagcccagatgtcagaatctgcaagttttgctgatcttgtcgggcaaaggaaaggtgagtccctggtggctgaggaggcccacagtcacctgtccctttctgaggtgggcacagaagagttcctgcagaaactcacctcacagatcaccgagatggtatcagccaagatctcgcaggccaaactccaggtgcctggaggtgacagtgatgaggagtctaagacaccatctgcttctcctcggcacggccggtcacgtccttcctccagtgttcaagagtcttcctcagagtcagaggatggagactcccgtggtgagatctttgacatctacgtggtcacagctgattatctgcccctgggagctgagcaggatgccatcatcctgagagaaggccagtatgtggaggtcctggactcagcccatcccctgcgctggcttgtacgcaccaagcccaccaaatccagcccttccaggcagggctgggtgtcacctgcctacctggacaagaggctcaagctatctcctgagtgggggcccactgaggcccctgagttccctggcgaggctgtgtctgaggatgagtatagaacgaggctgagctctgtcatccaggagttgctgagttcagagcaggcttttgtgggtgagttacagttcttggagagccaccacatcaagcacctggaccgatctccccgtgtacccgcagctgtggccagccagaagacggtcatctttcgtaatgtgcaggacatcagccatttccacagcagcttcttgaaggagctgcagagctgtggcaccgacgatgatgtagccatgtgcttcatcaagaaccaggaggcctttgagaagtaccttgagttcctggtgggccgggtgcaagcggaatcagtggtcgtcagcaccccagtccaggagttctacaagaaatatgcagaagagatgctgtcagccaaggaccccacacagccacccccacctcctcttcagcactacttggagcagccagtggaacgggtgcagaaataccaggccttgctgaaggagctaatccgcaacaaggctcgcaaccggcagaactgtgcgctgctggagcaggcctacgctgtggtgtctgccctgcctcagcgtgctgagaacaagctgcacgtttctctcatggagaactacccgggaaccctggaggccctgggagaacctatccgccagggtcacttcatagtgtgggagggggctccaggagcccggatgccttggaagggccacaaccggcatgtcttcctcttccgaaaccacctggtgatctgcaagccccggagagactctcgaacggacaccttcagctacgtgttccggaacatgatgaagctgaatagcatcgacctgaatgaccaggtagagggggatgaccgtgcctttgaggtgtggcacgagcgggaagactctgtccgcaagtacctgctgcaggcgcggacagtgatcatcaaaaactcatgggtgaaggagatctgtggcatccagcagcgccttgcccagcccgtgtggcgtccccctgagtttgaagaagaactagctgactgcacagccgagctgggtgaaacagtcaagctagcatgccgagtgactggcacacctaagcctattgtcagctggtacaaagatgggaagcccgtggaggtggacccacaccacatcctcattgaagaccctgatggctcctgtaccctcatcttggacaaccttactggcatagactctggccagtacatgtgttttgcggccagtgctgctggcaatgccagcaccttggggaagattctagtacaagtgcccccacgatttgtgaacaaggtccgagccacaccctttgtggagggagaggacgcgcagatcacctgcacagtggaaggagctccgtaccctcagatcaggtggtacaaggacggtgccctgctaaccctgggcaacaggtaccggatggtgaatgagccccgcagtggtatgctggtgctggtgatccaggcagccagcaaggaggacctgggacactatgaatgtgagttggtgaaccggttgggctcaacacgttgtggcggagaattatacatgcagagtcccgcactgcgtgcctgggaccagcaccaccgggaacagcttgtggctgctgtggaagacgcctccatggaggactctgcccaccccactcaggagggagctgaccaacaagccgcttctgtcctttggaggctgctgggctcagaagccctcagcccctccccagggggtttccccaacaccagacaaagtgagccacccacatcagaagaggctgctccccagatcccaggcacaacttcaggaacacctggcaaactcccagaggcttcacggcccggcacatacaaaggcctggagcaggggatgacaacaacttctggatcccaggaacggaatgtacccattcgggtggagggcacggcctggccaggcggaggcactgggcagctgctcttggatgtgcacagccaagtcatcatggagaccacacagaggacctatgtgtgccaagctcctgacacaggtgtcacaagggccccatccatgcaggtcactatcgaggacctacaagtacaagtgggtgacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtggaaggcctacactacctgcacagccatgatatcctccatctggacataaagccccccaacatcctgatggtccacccagctcgggaagacattaagatctgtgactttggctttgcccaaaagatcaccccgtcagagccacagtacagcaagtatggctcacctgaattcgtgtccccagagatcatcgagcagagtcctgtgagtgagggctcagacatctgggccatgggcgtcatctcctacctcagcctcacctgttcatccccattcgctggagagagtgaccgtgccaccctgctcaatgttttggaggggcgggtctcttggagcagtcccatggctgcccatctgagtgaggatgccaaggacttcatcaaggccacactgcaaaagacccccagggcccggcctagtgcttcccagtgccttgctcacccctggttcctgaagtccatgcctgctgaggaggcccacttcatcaacaccaaacagctcaagttccttcttgctcgcagtcgctggcagcgttccttgatgagctacaagtctatcctggtgatgcgctccatccctgagctgctccagggtcctccagacagtccatctctaggagtggcccggcacctacgaggggaagccagcggatcctctagctcatcgtcttcctcggacaatgagcttgccccatttgccagggctaagtcactgccaccttcccctgtcactcactcgccactgctgcaccctcggggctttctgcggccttcagccagcctcccggaggagacagaggccagcatgtccactgctgatgcagccatgccggcacccccccagagtgctgggcctccagcaagcccaggttgtgtgccccggcacagcgtcatcagcagcttgttctaccagcaagctggtgagggtgcagagcgtgggagcaaagcgttgggcgccaagaggcacccagctcggagacgccacctgctaaagggcgggtacattgcaagggccctgcccgggctacgagagccgctgatggagtttagtgtgttggaggaagaggctgctaatgaggagcaggcctctctgatgaccaagacaccctcctttgagaccgctctgcgactacctagttccaatgtcagagaggtcccaggccgaagccgctccctggacaacccaccaggcacagccagcccctctcctgaggcatacaaggaacaatacctgtccccaccctcctcggggttgactcatgaaaccaccgccaagggcatgggacacaaagaagggttcttgcaggagtctgtccccttttcacctaccagtggtgacctgaggcctgttaagcaagaggggtcatcccaggatagctgtagagggaaaccagcctcttcctgtcactctgaactgggttctggtccgcaggagggctgtggctctccatcatcacaattgtgtggctccttacctccacagtcatcgaagaaagagctctcaaaaccctgtggcccactcttttcagaacagcctcaggcagccccattcccagcgcaagcaagcccccttctgggttctcagaaggaacctcaggatagctatctacctgaaaagccatgtccagttccctccagttctccagggtcagcctcccaagtagatgcatccctggataccgaaggcttgtcggaagctggggacacatgtgacttcacgcctcctctccagcggcctcaggagcaggccaccacccggaagttctctctggaatcccgtgggggctatgcaggggtggcaggatatggcaccttcgcctttggtggggatgcaggggggatgttagggcagggtcccctttgggccaggatggcctgggctgtgtcccagtcctcagaagagcaagatgaagcagcgactgagagccctcaacctctggacagctcagggcccattgctgaggccagtggggttcccctaaggacctcgccaagcctcaccccatgggaggaagttgagcaggtttccctggtacagatccgggatctgtctggtgatgcagaagcagccgacaccatctccttggacatttcagaggtagatcctgcctacctcaacctctccgatctatatgacatcaagtatctcccgtttgagttcatgatcttcaggagggtccccaaacctgtagagcagccagagtcacctggctctgaaactgaagaggggcaagggctggcggagttcctggaggaggctgtgtggccctggccaggcgagctgggactgcgtgctggtctggagattacagaggagccacaggagccaggggacctggaagcactgctgggcgaggctgctgtgggcaggaagcgcaagtggtccccctcccgtggcctcttccaattccctgggaggtgcctgtcaggggaggagcccgtggagcttgggctgcgccagagggtgaaggcttccatggctcacatctccaggatcctgaagggcaagccggaaggtcctgagaaggaagggcctcccagaaagaaggcaggcctagcttctttccggctatcaggcctgaagggcagggaccaagcgccatccttcctaagagaactctctgatgaggctgtggtcctgggccaatcagtgacactggcctgccaggtgttggcccagccaactgcccaggctacctggagcaaagatggggcccttctggagagcagcggccacctcctcatctcttccaccctgaagaacttccagctgctgaccattctggtggtgacggaggaggatctgggcacatatacctgctgtgtgagcaacccactagggacagcagtcaccacaggtgtcctccggaaagcagagcgcccttcatcttctccacgcccggaggtgggggaactatacacggatgcagtgttgctggtctggaagcctgtggaatcctatggcccagtgacctacattgtgcagtgctgtatagaaggaggcagctggacaaccctggcctctgacatctccgactgctgctacctcactggcaagctgccccggggtggcatgtataccttccggacagcatgtgtcagcaaagcaggaatgggcccctacagtagcccctcagaacaggtcctccttggaggacccaaccacctggcttctgaggaggaaagcagccgggggagaccagcccagcttcttcccagcacaaagacttttgccttccagacacagatccggaggggccgcttcagtgtggtgaggcagtgtagggagaaagcaagtgggcgggccctggctgctaagatcgttccctaccagcctgaggacaagacaactgtactaagagaatatgaggcactaaagagactgcaccacccacatctggcccaactccatgctgcctacctcagtccccggcacctggtgctcatcctagagctgtgctctggccctgagctgctaccctctctggcggagagggactcgtactcagagtctgatgtgaaggactacctgtggcagatgctcagtgccacccagtacctgcatgcccaacacatcctgcacctggacctgaggtcggagaacatgatggtcaccgagtacaacctgcttaaggttatagacctgggtaacgcccagagtctcagccaagagaaggtcccacctcctgaaaacttcaaagactacctagagaccatggctccagaacttctggaaggccaaggggcggttccacagacagacatctgggctattggtgtaacagccttcattatgctgagtggcgagtacccagtgagcagcgaggggactcgcgacctgcagaaaggcctgcgcaagggactcattcaattgagtcgctgctatgcaggattatcagggggtgcggtagccttcctgcagagttcattgtgcgctcggccctggggtcgcccgtgcgcttccacctgcttgcagtgcgggtggctgacggaggagggccccaccggttcccggcccacgcccgtgaccttccccaccgcgcgattgcgtgcctttgtgcgcgagcgcgagaagcgccgggcgctactctacaagaagcacaacctggctcaggtgcgctgaggcccagccctacagagcaagatgtgcccgccaataaaagatgcaaaacagcca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]