GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2021-12-06 05:00:11, GGRNA.v2 : RefSeq release 208 (Sep, 2021)

LOCUS       XM_039057512             378 bp    mRNA    linear   PLN 12-FEB-2021
DEFINITION  Cantharellus anzutake uncharacterized protein (EI90DRAFT_3020538),
            partial mRNA.
ACCESSION   XM_039057512
VERSION     XM_039057512.1
DBLINK      BioProject: PRJNA691513
            BioSample: SAMN02745813
KEYWORDS    RefSeq.
SOURCE      Cantharellus anzutake
  ORGANISM  Cantharellus anzutake
            Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
            Agaricomycetes; Cantharellales; Cantharellaceae; Cantharellus.
REFERENCE   1  (bases 1 to 378)
  AUTHORS   Miyauchi,S., Kiss,E., Kuo,A., Drula,E., Kohler,A.,
            Sanchez-Garcia,M., Morin,E., Andreopoulos,B., Barry,K.W.,
            Bonito,G., Buee,M., Carver,A., Chen,C., Cichocki,N., Clum,A.,
            Culley,D., Crous,P.W., Fauchery,L., Girlanda,M., Hayes,R.D.,
            Keri,Z., LaButti,K., Lipzen,A., Lombard,V., Magnuson,J.,
            Maillard,F., Murat,C., Nolan,M., Ohm,R.A., Pangilinan,J.,
            Pereira,M.F., Perotto,S., Peter,M., Pfister,S., Riley,R.,
            Sitrit,Y., Stielow,J.B., Szollosi,G., Zifcakova,L., Stursova,M.,
            Spatafora,J.W., Tedersoo,L., Vaario,L.M., Yamada,A., Yan,M.,
            Wang,P., Xu,J., Bruns,T., Baldrian,P., Vilgalys,R., Dunand,C.,
            Henrissat,B., Grigoriev,I.V., Hibbett,D., Nagy,L.G. and Martin,F.M.
  TITLE     Large-scale genome sequencing of mycorrhizal fungi provides
            insights into the early evolution of symbiotic traits
  JOURNAL   Nat Commun 11 (1), 5125 (2020)
   PUBMED   33046698
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 378)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (12-FEB-2021) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 378)
  AUTHORS   Kuo,A., Miyauchi,S., Kiss,E., Drula,E., Kohler,A.,
            Sanchez-Garcia,M., Andreopoulos,B., Barry,K.W., Bonito,G., Buee,M.,
            Carver,A., Chen,C., Cichocki,N., Clum,A., Culley,D., Crous,P.W.,
            Fauchery,L., Girlanda,M., Hayes,R., Keri,Z., LaButti,K., Lipzen,A.,
            Lombard,V., Magnuson,J., Maillard,F., Morin,E., Murat,C., Nolan,M.,
            Ohm,R., Pangilinan,J., Pereira,M., Perotto,S., Peter,M., Riley,R.,
            Sitrit,Y., Stielow,B., Szollosi,G., Zifcakova,L., Stursova,M.,
            Spatafora,J.W., Tedersoo,L., Vaario,L.-M., Yamada,A., Yan,M.,
            Wang,P., Xu,J., Bruns,T., Baldrian,P., Vilgalys,R., Henrissat,B.,
            Grigoriev,I.V., Hibbett,D., Nagy,L.G. and Martin,F.M.
  CONSRTM   DOE Joint Genome Institute
  TITLE     Direct Submission
  JOURNAL   Submitted (24-OCT-2019) DOE Joint Genome Institute, 2800 Mitchell
            Drive, Walnut Creek, CA 94598-1698, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NW_024067032).
            
            ##Metadata-START##
            Organism Display Name :: Cantharellus anzutake C23 v1.0
            GOLD Stamp ID         :: Gp0022296
            ##Metadata-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..378
                     /organism="Cantharellus anzutake"
                     /mol_type="mRNA"
                     /strain="C23"
                     /db_xref="taxon:1750568"
                     /chromosome="Unknown"
     gene            <1..>378
                     /locus_tag="EI90DRAFT_3020538"
                     /db_xref="GeneID:62295163"
     CDS             1..378
                     /locus_tag="EI90DRAFT_3020538"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_038910433.1"
                     /db_xref="GeneID:62295163"
                     /db_xref="JGIDB:Cananz1_3020538"
                     /translation="
MIDNEVSTSPHAPPPFHDSEGDPVPSYQRINRNPETLARYLFRLGFIFPFFWMLAATIIVTDLVPTSYTPIAGKSPEEQQEEIEVHRATELKWAWRSVYALGGWIILAIIILGIMRATHTGFFAS"
ORIGIN      
atgatagacaacgaggtatccacttctccacacgcacctcctccattccacgattccgaaggtgatcccgtcccatcataccaacgcataaaccgaaacccagaaacgctcgccagatacctcttccgtttaggtttcatatttcccttcttctggatgctcgctgccaccatcattgttaccgacctcgttcctacttcatacactcccatcgctgggaaaagccccgaagagcaacaagaagagattgaagttcaccgtgccactgaactgaaatgggcatggagatcggtttatgcgttgggagggtggatcattttggccatcattatcttgggtatcatgcgtgccactcatactgggttcttcgcttcgtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]