2024-05-19 13:25:04, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_038423390 1027 bp mRNA linear MAM 07-JAN-2021 DEFINITION PREDICTED: Canis lupus familiaris copper chaperone for superoxide dismutase (CCS), transcript variant X1, mRNA. ACCESSION XM_038423390 VERSION XM_038423390.1 DBLINK BioProject: PRJNA681562 KEYWORDS RefSeq. SOURCE Canis lupus familiaris (dog) ORGANISM Canis lupus familiaris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Carnivora; Caniformia; Canidae; Canis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051822.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Canis lupus familiaris Annotation Release 106 Annotation Version :: 106 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1027 /organism="Canis lupus familiaris" /mol_type="mRNA" /isolate="SID07034" /sub_species="familiaris" /db_xref="taxon:9615" /chromosome="18" /sex="male" /tissue_type="fibroblast, soft palate" /dev_stage="adult" /breed="Labrador retriever" gene 1..1027 /gene="CCS" /note="copper chaperone for superoxide dismutase; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs, 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 35 samples with support for all annotated introns" /db_xref="GeneID:442988" /db_xref="VGNC:VGNC:38919" CDS 98..865 /gene="CCS" /codon_start=1 /product="copper chaperone for superoxide dismutase isoform X1" /protein_id="XP_038279318.1" /db_xref="GeneID:442988" /db_xref="VGNC:VGNC:38919" /translation="
MTCQSCVDAVRTSLQGVAGIQSVKVQLENQMVLVQTTLPSQEVQALLESTGRQAVLKGMGSGLLQNLGAAVAILEGPGPVQGVVRFLQLTPERCLIEGTIDGLEPGLHGLHVHQFGDLTGNCNSCGDHFNPDGASHGGPKDSDRHRGDLGNVHAGTDGRAIFRIEDEQLKVWDVIGRSLVIDEGEDDLGLGGHPLSKVTGNSGERLACGIIARSAGLFQNPKQICSCDGLTIWEERGRPIAGEGRKEPAKPPAHL"
misc_feature 98..799 /gene="CCS" /note="copper, zinc superoxide dismutase; Region: PLN02957" /db_xref="CDD:215516" ORIGIN
ccggtgacggggtccgggatggcttcggactccgaggaccgcgggaccgcctgcacgcctgtccctgccggccttgcagctggagttcacagtgcagatgacctgtcagagctgcgtggacgcggtgcgcacgtccctgcaaggggtggcaggcatccagagtgttaaagtgcagttggaaaaccagatggtcctggtgcagaccaccctgcccagccaagaggtgcaggcccttctggaaagcacagggcggcaggcagtactcaagggcatgggcagtggcctcctgcagaatctgggagcagcagttgccattctggagggccctggtcccgtgcaaggggtggtgcgcttcctacagctgacccctgaacgctgcctcatcgaggggactatcgatggcctggagcctgggctgcatggactccatgtccatcagtttggagacctcaccgggaactgcaacagctgcggggaccactttaaccctgatggagcatctcacgggggccctaaggactctgaccggcaccgtggggacctggggaatgtccatgctggcactgatggccgagccatcttcaggatagaggatgagcagctgaaggtatgggatgtgattggccgaagcctggtcatcgatgaaggagaagatgatctgggcctgggtggccatcccttatccaaggtcacaggaaactcaggagagaggttggcctgtggcatcatcgcacgctctgctggccttttccagaaccctaagcagatctgctcctgtgatggccttaccatctgggaggagcgaggccggcccattgctggtgagggacgaaaggagccagccaagccccctgcccacctctgaacatggcctcagcttcgggtttgttctcccagctgtgcactgtctacttccagagagaggggagggaggccctgcttgcccagtcctaggaggacttgggtacagggtgtgaaggttgctgtgatgttcccttgcaaattaaagttttattttcctacagaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]