2024-04-24 03:02:58, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_037997067 3101 bp mRNA linear PRI 01-DEC-2020 DEFINITION PREDICTED: Chlorocebus sabaeus argonaute RISC catalytic component 3 (LOC103225123), transcript variant X4, mRNA. ACCESSION XM_037997067 VERSION XM_037997067.1 DBLINK BioProject: PRJNA680339 KEYWORDS RefSeq. SOURCE Chlorocebus sabaeus (Cercopithecus sabaeus) ORGANISM Chlorocebus sabaeus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Cercopithecidae; Cercopithecinae; Chlorocebus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_023666033.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Chlorocebus sabaeus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3101 /organism="Chlorocebus sabaeus" /mol_type="mRNA" /strain="WHO RCB 10-87" /db_xref="taxon:60711" /chromosome="Unknown" /sex="female" /tissue_type="kidney epithelium" gene 1..3101 /gene="LOC103225123" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs, 10 Proteins, and 99% coverage of the annotated genomic feature by RNAseq alignments, including 22 samples with support for all annotated introns" /db_xref="GeneID:103225123" CDS 503..2383 /gene="LOC103225123" /codon_start=1 /product="protein argonaute-3 isoform X4" /protein_id="XP_037852995.1" /db_xref="GeneID:103225123" /translation="
MCEVLDIHNIDEQPRPLTDSHRVKFTKEIKGLKVEVTHCGTMRRKYRVCNVTRRPASHQTFPLQLENGQTVERTVAQYFREKYTLQLKYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIKATARSAPDRQEEISRLVRSANYETDPFVQEFQFKVRDEMAHVTGRVLPAPMLQYGGRNRTVATPSHGVWDMRGKQFHTGVEIKMWAIACFATQRQCREEILKGFTDQLRKISKDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYSGLQLIIVILPGKTPVYAEVKRVGDTLLGMATQCVQVKNVIKTSPQTLSNLCLKINVKLGGINNILVPHQRPSVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPSRYCATVRVQRPRQEIIQDLASMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFRQVLYYELLAIREACISLEKDYQPGITYIVVQKRHHTRLFCADRTERVGRSGNIPAGTTVDTDITHPYEFDFYLCSHAGIQGTSRPSHYHVLWDDNCFTADELQLLTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHVSGQSNGRDPQALAKAVQIHQDTLRTMYFA"
misc_feature 503..844 /gene="LOC103225123" /note="PAZ domain, argonaute_like subfamily. Argonaute is part of the RNA-induced silencing complex (RISC), and is an endonuclease that plays a key role in the RNA interference pathway. The PAZ domain has been named after the proteins Piwi,Argonaut, and Zwille; Region: PAZ_argonaute_like; cd02846" /db_xref="CDD:239212" misc_feature order(638..640,683..685,725..727,737..739,791..793, 812..814,818..820) /gene="LOC103225123" /note="nucleic acid-binding interface [nucleotide binding]; other site" /db_xref="CDD:239212" misc_feature 977..2254 /gene="LOC103225123" /note="PIWI domain, Argonaute-like subfamily. Argonaute is the central component of the RNA-induced silencing complex (RISC) and related complexes. The PIWI domain is the C-terminal portion of Argonaute and consists of two subdomains, one of which provides the...; Region: Piwi_ago-like; cd04657" /db_xref="CDD:240015" misc_feature order(1388..1390,1400..1402,1436..1447,1454..1456, 1478..1480,1487..1489,1499..1501,1511..1513) /gene="LOC103225123" /note="5' RNA guide strand anchoring site [active]" /db_xref="CDD:240015" misc_feature order(1592..1594,1598..1600,1808..1810,2222..2224) /gene="LOC103225123" /note="active site" /db_xref="CDD:240015" ORIGIN
aatcaaatttgtctctcgggtgagttggcatctactgcatgaagtactgacaggacggaccttgcctgagccactggaattagacaagccaatcagcactaaccctgtccatgccgttgatgtggtgctacgacatctgccctccatgaaatacacgcctgtggggcgttcatttttctctgctccagaaggatatgaccaccctctgggaggaggcagggaagtgtggtttggattccatcagtctgttcggcctgccatgtggaaaatgatgcttaatattgatgaaagagacctctggcagcagtgtggagaatagatagaggagaaaaaactaatctgagaagccagttaggaggcttttcaatcactagttcaggtttcagtctacatgttacttccttgagaagcagtgtttgacacccttctccccccatccagccatcccccaagtctgatttctgccactgccttctacaaagcacaacctgtaattcagttcatgtgtgaagttcttgatattcataatattgatgagcaaccaagacctctgactgattctcatcgggtaaaattcaccaaagagataaaaggtttgaaggttgaagtgactcattgtggaacaatgagacggaaataccgtgtttgtaatgtaacaaggaggcctgccagtcatcaaacctttcctttacagttagaaaatggccaaactgtggagagaacagtagcgcagtatttcagagaaaagtatactcttcagctgaagtacccgcaccttccctgcctgcaagtcgggcaggagcagaaacacacctacctgccgctagaagtctgtaatattgtggcagggcaacgatgtatcaagaagctaacagacaatcagacttccactatgatcaaggcaacagcaagatctgcaccagatagacaagaggaaattagcagattggtaagaagtgcaaattatgaaacggatccatttgttcaggagtttcaatttaaagttcgggatgaaatggctcatgtaactggacgcgtacttccagcacctatgctccagtatggaggacggaatcggacagtagcaacaccaagccacggagtatgggatatgcgagggaagcaattccacacaggagttgaaatcaaaatgtgggctatcgcttgttttgccacacagaggcagtgcagagaagaaatattgaagggtttcacagaccagctgcgtaagatttctaaggatgcagggatgcccatccagggccagccatgcttctgcaaatatgcacagggggcagacagcgtagagcccatgttccggcatctcaagaacacatattctggcctacagcttattatcgtcatcctgccagggaagacaccagtgtatgcggaagtgaaacgtgtaggagacacacttttgggtatggccacacaatgtgttcaagtcaagaatgtaataaaaacatctcctcaaactctctcaaacttgtgcctaaagataaatgttaaactcggaggaatcaataatatccttgtacctcatcaaagaccttctgtgttccagcaaccagtgatctttttgggagccgatgtcactcatccacctgctggtgatggaaagaagccttctattgctgctgttgtaggtagtatggatgcccacccaagcagatactgtgccacagtaagagttcagagaccccgacaggagatcatccaggatttggcctccatggtccgggaacttcttattcaattttataagtcaactcggttcaagcctactcgtatcatcttttatcgggatggtgtttcagaggggcagtttaggcaggtattatattatgaactactagcaattcgagaagcctgcatcagtttggagaaagactatcaacctggaataacctacattgtagttcagaagagacaccacactcgattattttgtgctgataggacagaaagggttggaagaagtggcaatatcccagctggaacaacagttgatacagacattacacacccatatgagtttgatttttacctctgtagccatgctggaatacagggtaccagtcgtccttcacactatcatgttttatgggatgataactgcttcactgcagatgaacttcagctgctaacttaccagctctgccatacttatgtacgctgtacacgatctgtttctatacctgcaccagcgtattacgctcacctggtagcatttagagccagatatcatcttgtggacaaagaacatgacagtgctgaaggaagtcacgtttcaggacagagcaatgggcgagatccacaagctcttgccaaggctgtacagattcaccaagataccttacgcacaatgtactttgcttaaatagttcaagtatattctctgagaggaagcactgaaagatgaattgacatacaacgtatgtttccagtggagtcaattgagtaaggacacctccagccatacagaaaccaacactgtgtgggggccaaggtctgatccttatgttaatacaaggaagattgtttacttcatcaaggaacacagcatcattatgcaatatgaaaccagccaactgctttttgtgcggtctcctgtaggaagtatcgcaattgttttgttttcatttcttgtagtctaacccttttaatgcctttacctcaagttgcttggcagcacaactatctttgcaaaaaaagtatcgaaaaagtaaatgatggtttaaaaaatatacaccttcatgaataatcaaagtgatttttcaaaattatatgtgcaaaaaattaatgtgcattcatatattcttgtaaaaggtgtctgtgtatttttaaaatatatacatccatacttcatatgcatatatatctggatctggattgataatagatatatatgtgtctgtgtatatattttagaattcattccatttggggaacttcctttcccttttattctactagcactaccgcttttatttctctttttcccttgccttcatcacctacattttttccctaatcctaccagtgacattcaaatattcacctacctggttcgtttgaatgtaaaatatggcaaacta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]