2024-05-20 07:36:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_037037954 2034 bp mRNA linear MAM 14-JUN-2021 DEFINITION PREDICTED: Sturnira hondurensis copper-transporting ATPase 1-like (LOC118981214), partial mRNA. ACCESSION XM_037037954 VERSION XM_037037954.1 DBLINK BioProject: PRJNA673222 KEYWORDS RefSeq; corrected model; includes ab initio. SOURCE Sturnira hondurensis ORGANISM Sturnira hondurensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera; Phyllostomidae; Stenodermatinae; Sturnira. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_023507979.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Updated annotation Annotation Name :: Sturnira hondurensis Updated Annotation Release 100.20210611 Annotation Version :: 100.20210611 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 9.0 Annotation Method :: Best-placed RefSeq; propagated RefSeq model Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 2% of CDS bases frameshifts :: corrected 1 indel ##RefSeq-Attributes-END## COMPLETENESS: incomplete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-57 VSFL01002032.1 33557-33613 c 58-198 VSFL01002032.1 31165-31305 c 199-688 VSFL01002032.1 21467-21956 c 689-1417 VSFL01002032.1 20015-20743 c 1418-1624 VSFL01002032.1 10227-10433 c 1625-1788 VSFL01002032.1 5554-5717 c 1789-2001 VSFL01002032.1 1741-1953 c 2002-2034 VSFL01002032.1 1706-1738 c FEATURES Location/Qualifiers source 1..2034 /organism="Sturnira hondurensis" /mol_type="mRNA" /isolate="20B" /db_xref="taxon:192404" /chromosome="Unknown" /tissue_type="liver" /dev_stage="adult" /ecotype="Veracruz" gene 1..>2034 /gene="LOC118981214" /note="The sequence of the model RefSeq transcript was modified relative to its source genomic sequence to represent the inferred CDS: deleted 2 bases in 1 codon; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 11 Proteins, and 92% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:118981214" CDS 1..>2034 /gene="LOC118981214" /note="The sequence of the model RefSeq protein was modified relative to its source genomic sequence to represent the inferred CDS: deleted 2 bases in 1 codon" /codon_start=1 /product="LOW QUALITY PROTEIN: copper-transporting ATPase 1-like" /protein_id="XP_036893849.1" /db_xref="GeneID:118981214" /translation="
MLLDALVLGVASLLIAACQECKEEIKVDPNMSVNSVSISVEGMTCSSCVWTIEQQIGKLNGVHHIKVSLEEKNATIIYDPKLQTAETMQEAIDDMGFDAILHNPHPVPVSTDTVCLRVPGSLTAPWDHIQSTLLKAKGVTDINISPQQRSAVVTIIPSLVNAGQIMELVPDLSFDTGTVEKKSGTCEDYRVAPAGEVKLKMKVEGMTCHSCTSTIEGKIGKLQGVQQIKVSLDNQEATVVYQPHLITGEEIKKQIEAAGFPAFIKKQPKYPKLGAIDIERLKNTPVKSSEGSQPRSLACADDYSTATFTIDGMHCKSCVSNIESALSALQYVSSIAVSLENRSAVVKYNANLVTPEALRKAIEAVPPGQYRVSITGGVDSTSNSPSSSCLQKLPLHVVSQPLTQETVINIDGMTCNSCVQSIEGFISKKAGVKSILVSLANSNGTVEYDPLLTSPETLRKAIEDMGFDATLPDTNEPLVVIAQPSSEMPHLTSTNEFHTKMMTPVHDKEDVKTSSKCYIQVTGMTCASCVANIERNLRREEGIYSVLVALMAGKAEVRYNPAVIQPPMIAEFIRELGFGATVIENADEGDGVLELIVRGMTCASCVHKIESTLTKHRGIFYCSVALATNKAHIKYDPEIIGPRDIIHTIEVSATFFVLACLVSIPFEGFWFVSDRGNE"
misc_feature 112..297 /gene="LOC118981214" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(127..135,142..144) /gene="LOC118981214" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 598..786 /gene="LOC118981214" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(616..624,631..633) /gene="LOC118981214" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 919..1092 /gene="LOC118981214" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(937..945,952..954) /gene="LOC118981214" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1219..1410 /gene="LOC118981214" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1237..1245,1252..1254) /gene="LOC118981214" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1555..1743 /gene="LOC118981214" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1570..1578,1585..1587) /gene="LOC118981214" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" misc_feature 1780..1950 /gene="LOC118981214" /note="Heavy-metal-associated domain (HMA) is a conserved domain of approximately 30 amino acid residues found in a number of proteins that transport or detoxify heavy metals, for example, the CPx-type heavy metal ATPases and copper chaperones. HMA domain...; Region: HMA; cd00371" /db_xref="CDD:238219" misc_feature order(1798..1806,1813..1815) /gene="LOC118981214" /note="metal-binding site [ion binding]" /db_xref="CDD:238219" ORIGIN
atgttgttggatgctcttgttctcggagtcgcctcattactaatagctgcatgccaggaatgtaaagaagaaatcaaagtggatccaaatatgagtgtgaattctgtcagcatctctgtagagggaatgacatgtagttcgtgcgtttggaccattgagcagcagattggaaaactgaatggtgtgcatcacattaaagtctcactggaagaaaaaaatgcaactattatttatgaccctaaactacagactgcagagaccatgcaggaagctatcgatgacatgggcttcgatgctattctccacaatccccaccctgtccctgtttcaaccgacaccgtgtgtctgagagttcctggttcgctgacggcgccatgggaccatatccaaagcacactgctgaaggccaagggtgtcacagacattaatatttcccctcagcaaagaagtgcagtggtgacaataatcccttctttagtgaatgccggtcagataatggagctggttcccgatctcagtttcgacactggaactgtggagaaaaagtcagggacctgtgaagattacagagtggctccagcaggtgaagtcaagctgaagatgaaagtggaggggatgacctgccattcatgcacgagcaccattgaagggaagatagggaaactgcagggtgttcagcaaattaaagtctcccttgacaaccaagaagctactgttgtttatcaacctcatcttatcacaggagaggaaatcaagaagcagattgaagctgcgggctttccagcattcatcaaaaaacagcccaagtaccccaagttgggagctattgatatagaacgtctaaaaaacaccccagtcaaatcttcagaaggatcacagccacggagtctggcatgtgccgatgattattccacagccactttcaccatagatggcatgcattgtaaatcatgtgtgtcaaatattgaaagtgctttatctgcactccaatatgtaagcagcatagcagtttctttagagaatagatctgctgtcgtcaagtacaatgcaaacttagtcactccagaagccctgagaaaagcaatagaggccgtaccaccaggacaatatagagtcagtattacaggtggagttgacagtacctcaaactctccttccagctcctgtcttcagaagcttcccttgcacgtagttagccagcccctgactcaagaaactgtgataaacatcgatggcatgacttgtaactcttgtgtgcagtctattgagggcttcatatcaaaaaaggcaggggtgaaatccatactagtatccctggcaaacagcaatggaactgtagaatacgaccctctgctaacctctccagaaactttgaggaaagcaatagaagacatgggatttgatgctaccttgccagatacaaatgagccattggtagtaatagctcagccctcatcggaaatgccacatttgacctcaactaatgaatttcatactaaaatgatgacaccagttcatgacaaggaggacgtaaagacttcatctaagtgttacatacaggtcactggtatgacctgtgcttcctgtgtagcaaacattgaacggaatttaagacgagaagaaggaatatattctgtactggtggctctgatggctggcaaggcagaagtgagatataatcctgctgttatacaacccccgatgatagccgagttcatccgagagcttggatttggagccactgtgatagaaaatgccgatgaaggggatggtgttttggaacttattgtaagaggaatgacatgtgcatcctgtgtacataaaatagaatctaccctcacaaagcacagagggattttctactgctctgtggccctggcaaccaacaaagcacatattaaatatgatccagaaattattggtcccagagatattatccatacaattgaagtaagtgccactttctttgttcttgcctgtttagtcagcataccctttgaaggcttctggtttgtatcagatagagggaatgaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]