2024-05-20 09:43:46, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_036536563 869 bp mRNA linear VRT 13-OCT-2020 DEFINITION PREDICTED: Megalops cyprinoides uncharacterized G-patch domain protein DDB_G0278987-like (LOC118782936), mRNA. ACCESSION XM_036536563 VERSION XM_036536563.1 DBLINK BioProject: PRJNA667936 KEYWORDS RefSeq; includes ab initio. SOURCE Megalops cyprinoides (Indo-Pacific tarpon) ORGANISM Megalops cyprinoides Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Elopiformes; Megalopidae; Megalops. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_050591.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Megalops cyprinoides Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.5 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 9% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..869 /organism="Megalops cyprinoides" /mol_type="mRNA" /isolate="fMegCyp1" /db_xref="taxon:118141" /chromosome="9" /tissue_type="whole body" /dev_stage="adult" /country="Singapore" /lat_lon="1.3521 N 103.8198 E" /collection_date="24-Aug-2018" /collected_by="Byrappa Venkatesh" gene 1..869 /gene="LOC118782936" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 91% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:118782936" CDS 60..869 /gene="LOC118782936" /codon_start=1 /product="uncharacterized G-patch domain protein DDB_G0278987-like" /protein_id="XP_036392456.1" /db_xref="GeneID:118782936" /translation="
MDFTRPKAGGLETDRTAQTIRDGEGVVSGPQDGARDGGASDGYKPSGVSDKTGTSSELKTSGGIGDKTGTQNKSDVIGKKMEPAYSCDSSLSSSDSDDEGYVKEKKKKKKKKKKKHKKKPMSDGKCMFLQVWMCGKTSCAIPVYSLPFSLLQDSSSSSSSSSSSSSSSSSDSSSSSSDSEDEEKYGEKKKKKKKKKKEMKKKEVKDGQDGISDIVIGEGGIELISLEDLSGEERKKEKAKKKKKKKKKKDSGSSSSSDSSSSSSDKTNC"
ORIGIN
caggttcaggtgagcgaagcggaacctttgcagaattggctggaaagcgctcgaattgaatggatttcacccggcccaaagcgggcgggttggagacggacaggaccgcgcagacgatccgtgacggggagggggtcgtcagcggtcctcaggatggggcgcgggacggcggcgcaagcgatgggtacaaaccttcaggcgtgtcagacaagacgggcactagctccgagctgaagacctctggaggaattggtgacaagacagggacacagaataagagtgatgtcatcgggaaaaagatggagcctgcttattcttgtgatagctcattgtcatcctctgacagtgatgatgaaggatacgtaaaggagaaaaagaagaagaaaaagaagaagaagaagaaacacaagaaaaagcctatgtctgatggaaaatgcatgtttctgcaagtgtggatgtgtgggaagaccagttgtgcaataccagtttactccttgcccttttctcttctacaggactccagctcctcttcctcctcctcctcctcctcctcctcttcctcctcctctgacagctcgtcctcttcctcagacagtgaggatgaggagaagtatggagagaagaagaagaagaaaaagaaaaagaagaaggagatgaagaagaaggaagtaaaagatgggcaggatggcatatctgatattgttataggtgagggaggcatagaattaatatcccttgaagatctaagcggtgaagagagaaagaaagagaaggcaaagaagaagaagaagaagaagaagaagaaggactctggctcatcttcctcctctgatagctcctcctcttcttcggacaagacaaactgctga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]